Incidental Mutation 'R5310:Cemip'
ID404786
Institutional Source Beutler Lab
Gene Symbol Cemip
Ensembl Gene ENSMUSG00000052353
Gene Namecell migration inducing protein, hyaluronan binding
Synonyms6330404C01Rik, 9930013L23Rik, 12H19.01.T7
MMRRC Submission 042893-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R5310 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location83932857-84086502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83992033 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 261 (L261H)
Ref Sequence ENSEMBL: ENSMUSP00000063277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064174]
Predicted Effect probably damaging
Transcript: ENSMUST00000064174
AA Change: L261H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063277
Gene: ENSMUSG00000052353
AA Change: L261H

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
G8 44 166 9.01e-42 SMART
Pfam:ILEI 187 281 2.1e-28 PFAM
Pfam:Mucin2_WxxW 324 403 1.2e-13 PFAM
PbH1 572 594 7.34e3 SMART
PbH1 595 617 3.73e3 SMART
PbH1 719 741 4.11e3 SMART
PbH1 798 819 6.96e2 SMART
Blast:PbH1 844 882 7e-17 BLAST
Blast:PbH1 917 952 2e-15 BLAST
Pfam:ILEI 1244 1334 2.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147578
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150495
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.7%
Validation Efficiency 100% (74/74)
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in Schwann cells exhibit transient acceleration of postnatal myelination, reduced demyelination in culture, and reduced myelin degradation and increases remyelination following nerve axotomy or sciatic nerve crush. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A C 1: 26,685,088 V337G probably benign Het
Abca15 A T 7: 120,332,616 I31L possibly damaging Het
Abca17 T C 17: 24,281,230 K1329R probably benign Het
Acap2 A G 16: 31,133,609 Y197H probably benign Het
Adgrv1 A G 13: 81,476,690 V3720A possibly damaging Het
Alms1 T A 6: 85,615,368 S870T possibly damaging Het
Anapc4 A G 5: 52,859,159 E493G probably benign Het
Ap2a1 A G 7: 44,906,065 probably null Het
Arhgef38 A G 3: 133,116,466 L179P probably damaging Het
Bicral T C 17: 46,813,983 D630G possibly damaging Het
Ccdc97 A T 7: 25,715,776 L154Q probably damaging Het
Cd40 T C 2: 165,063,563 probably null Het
Celsr1 T A 15: 85,926,222 N2155I possibly damaging Het
Cep57 G A 9: 13,818,868 H98Y probably damaging Het
Chrna7 A T 7: 63,106,057 L247Q probably damaging Het
Cyp2c40 T A 19: 39,778,030 M374L probably damaging Het
Cyp4f13 T C 17: 32,925,821 D372G probably damaging Het
Dazl C A 17: 50,281,283 S288I probably damaging Het
Dnah5 T C 15: 28,311,328 F1818L probably damaging Het
Echdc1 T C 10: 29,334,208 V143A possibly damaging Het
Eif4enif1 T A 11: 3,242,687 H838Q probably damaging Het
Erich3 A T 3: 154,763,580 D1223V probably damaging Het
Fbxl2 A G 9: 113,986,508 I229T possibly damaging Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Ggnbp2 A G 11: 84,869,968 M1T probably null Het
Glb1l2 C T 9: 26,796,866 probably benign Het
Gnl2 A G 4: 125,052,840 K618R probably benign Het
Greb1 A T 12: 16,716,759 I346K probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Gtse1 A G 15: 85,873,792 Q533R probably benign Het
Hemgn A G 4: 46,403,927 S23P possibly damaging Het
Htr6 G T 4: 139,061,666 H359Q probably damaging Het
Ifit1 T C 19: 34,648,804 F447L probably benign Het
Kansl1 T C 11: 104,424,858 Y118C possibly damaging Het
Khk G A 5: 30,927,029 V118M probably benign Het
Klra17 T A 6: 129,868,708 K181M probably damaging Het
Lbh T C 17: 72,921,292 probably null Het
Lmo2 T C 2: 103,976,100 I108T probably damaging Het
Mgat5 T A 1: 127,387,514 probably null Het
Mink1 T C 11: 70,607,343 V525A probably benign Het
Myo10 C A 15: 25,778,078 probably null Het
Nlrp2 T C 7: 5,325,008 N682S probably benign Het
Nr2e3 G A 9: 59,949,334 probably benign Het
Olfr1415 T C 1: 92,491,036 T240A probably damaging Het
Olfr467 T C 7: 107,814,964 C129R probably damaging Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pfas G A 11: 68,988,021 S1319F probably damaging Het
Phf3 T C 1: 30,803,806 K2024R probably damaging Het
Pld4 G A 12: 112,768,612 C501Y probably damaging Het
Psg16 C T 7: 17,090,635 R115W probably damaging Het
Rab3gap1 G A 1: 127,942,373 probably null Het
Rimkla C A 4: 119,477,852 K111N probably damaging Het
Rrm2b T C 15: 37,927,327 E113G probably damaging Het
Rspry1 C T 8: 94,623,185 T67I probably benign Het
Skint6 C A 4: 113,184,768 E292* probably null Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc13a1 A G 6: 24,134,374 M170T probably benign Het
Slc15a5 T C 6: 138,073,036 N127S probably benign Het
Slc39a10 G A 1: 46,836,125 H6Y probably damaging Het
Sugct A T 13: 17,252,560 C338* probably null Het
Tbk1 A T 10: 121,556,051 M486K probably benign Het
Terf1 A T 1: 15,805,685 E3V probably damaging Het
Thoc5 T A 11: 4,910,648 Y246N probably damaging Het
Tmem167b G A 3: 108,562,099 probably benign Het
Tmem57 T C 4: 134,837,019 probably benign Het
Tmtc1 T A 6: 148,355,412 probably benign Het
Zfp322a A T 13: 23,357,362 M70K possibly damaging Het
Zfp979 A T 4: 147,613,918 H111Q possibly damaging Het
Other mutations in Cemip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Cemip APN 7 83947280 missense possibly damaging 0.63
IGL01520:Cemip APN 7 83948622 missense probably benign 0.27
IGL01646:Cemip APN 7 83983232 missense possibly damaging 0.81
IGL02057:Cemip APN 7 83987453 missense probably damaging 1.00
IGL02058:Cemip APN 7 83997292 missense probably damaging 0.99
IGL02120:Cemip APN 7 83951563 missense probably damaging 0.99
IGL02278:Cemip APN 7 83937438 missense probably damaging 1.00
IGL02331:Cemip APN 7 83963984 critical splice donor site probably null
IGL02366:Cemip APN 7 83943641 missense probably benign 0.08
IGL02434:Cemip APN 7 83955284 missense probably damaging 0.98
IGL02622:Cemip APN 7 83964175 missense probably damaging 1.00
IGL02958:Cemip APN 7 83975055 missense probably damaging 0.99
IGL02979:Cemip APN 7 84003306 splice site probably benign
IGL03280:Cemip APN 7 83987330 splice site probably benign
IGL03400:Cemip APN 7 83958516 missense probably damaging 0.96
IGL03134:Cemip UTSW 7 83999237 missense probably damaging 1.00
PIT4618001:Cemip UTSW 7 83943939 missense probably benign 0.07
R0149:Cemip UTSW 7 83964010 missense probably benign
R0212:Cemip UTSW 7 83973190 missense probably damaging 0.99
R0361:Cemip UTSW 7 83964010 missense probably benign
R0565:Cemip UTSW 7 83964110 missense probably damaging 0.99
R0727:Cemip UTSW 7 83961578 missense probably benign 0.00
R1342:Cemip UTSW 7 83944075 nonsense probably null
R1456:Cemip UTSW 7 83998510 missense possibly damaging 0.96
R1526:Cemip UTSW 7 83951440 missense probably damaging 1.00
R1676:Cemip UTSW 7 83964038 missense possibly damaging 0.77
R1718:Cemip UTSW 7 83935658 missense probably benign 0.00
R2234:Cemip UTSW 7 83998562 missense probably benign 0.02
R2513:Cemip UTSW 7 83942025 missense probably benign 0.11
R3788:Cemip UTSW 7 83943898 missense probably damaging 1.00
R3964:Cemip UTSW 7 83951509 missense probably benign 0.43
R3966:Cemip UTSW 7 83951509 missense probably benign 0.43
R4436:Cemip UTSW 7 83987429 missense probably null 0.43
R4584:Cemip UTSW 7 83958539 missense probably damaging 1.00
R4601:Cemip UTSW 7 83951618 missense probably damaging 0.98
R4717:Cemip UTSW 7 83947280 missense probably damaging 0.97
R4767:Cemip UTSW 7 83973306 missense probably damaging 1.00
R4822:Cemip UTSW 7 83973241 missense probably benign 0.27
R4849:Cemip UTSW 7 83935737 missense possibly damaging 0.52
R4910:Cemip UTSW 7 83997411 missense probably damaging 1.00
R4911:Cemip UTSW 7 83983253 missense probably damaging 1.00
R4922:Cemip UTSW 7 83947100 intron probably benign
R4924:Cemip UTSW 7 83952938 missense probably damaging 1.00
R5090:Cemip UTSW 7 83942135 missense probably damaging 1.00
R5327:Cemip UTSW 7 83955301 missense probably damaging 0.99
R5378:Cemip UTSW 7 83958525 missense probably damaging 1.00
R5444:Cemip UTSW 7 83982291 missense probably damaging 0.98
R5644:Cemip UTSW 7 83989184 missense probably benign 0.03
R5688:Cemip UTSW 7 83961641 missense probably damaging 1.00
R5714:Cemip UTSW 7 83975179 missense probably damaging 1.00
R6170:Cemip UTSW 7 83947230 missense possibly damaging 0.89
R6505:Cemip UTSW 7 83951597 nonsense probably null
R6713:Cemip UTSW 7 83943637 missense probably benign 0.03
R6767:Cemip UTSW 7 83998624 missense probably damaging 1.00
R6817:Cemip UTSW 7 83987992 missense probably damaging 1.00
R6896:Cemip UTSW 7 83998576 missense probably damaging 1.00
R6945:Cemip UTSW 7 83998547 missense probably damaging 1.00
R7236:Cemip UTSW 7 83948804 splice site probably null
R7410:Cemip UTSW 7 83952834 missense probably damaging 1.00
R7483:Cemip UTSW 7 83998576 missense probably damaging 0.99
T0970:Cemip UTSW 7 83983146 missense probably damaging 0.99
X0067:Cemip UTSW 7 83947208 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGCCTTTGAGCACCATGCC -3'
(R):5'- GTACATAGGTCACTGTCTCTTTCAG -3'

Sequencing Primer
(F):5'- AGCACCATGCCTGAGTTTG -3'
(R):5'- TTTCAGACTGCTGCCAAGAC -3'
Posted On2016-07-22