Mutagenetix > Incidental Mutations

Incidental Mutation 'R5310:Cemip'

404786

Institutional Source

Beutler Lab

Gene Symbol

Cemip

Ensembl Gene

ENSMUSG00000052353

Gene Name

cell migration inducing protein, hyaluronan binding

Synonyms

6330404C01Rik, 9930013L23Rik, 12H19.01.T7

MMRRC Submission

042893-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.082) question?

Stock #

R5310 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83932857-84086502 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 83992033 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 261 (L261H)

Ref Sequence

ENSEMBL: ENSMUSP00000063277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064174]

Predicted Effect

probably damaging
Transcript: ENSMUST00000064174
AA Change: L261H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000063277
Gene: ENSMUSG00000052353
AA Change: L261H

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
G8	44	166	9.01e-42	SMART
Pfam:ILEI	187	281	2.1e-28	PFAM
Pfam:Mucin2_WxxW	324	403	1.2e-13	PFAM
PbH1	572	594	7.34e3	SMART
PbH1	595	617	3.73e3	SMART
PbH1	719	741	4.11e3	SMART
PbH1	798	819	6.96e2	SMART
Blast:PbH1	844	882	7e-17	BLAST
Blast:PbH1	917	952	2e-15	BLAST
Pfam:ILEI	1244	1334	2.7e-17	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147578

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150495

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.9%
20x: 96.7%

Validation Efficiency

100% (74/74)

MGI Phenotype

PHENOTYPE: Mice homozygous for a conditional allele activated in Schwann cells exhibit transient acceleration of postnatal myelination, reduced demyelination in culture, and reduced myelin degradation and increases remyelination following nerve axotomy or sciatic nerve crush. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	A	C	1: 26,685,088	V337G	probably benign	Het
Abca15	A	T	7: 120,332,616	I31L	possibly damaging	Het
Abca17	T	C	17: 24,281,230	K1329R	probably benign	Het
Acap2	A	G	16: 31,133,609	Y197H	probably benign	Het
Adgrv1	A	G	13: 81,476,690	V3720A	possibly damaging	Het
Alms1	T	A	6: 85,615,368	S870T	possibly damaging	Het
Anapc4	A	G	5: 52,859,159	E493G	probably benign	Het
Ap2a1	A	G	7: 44,906,065		probably null	Het
Arhgef38	A	G	3: 133,116,466	L179P	probably damaging	Het
Bicral	T	C	17: 46,813,983	D630G	possibly damaging	Het
Ccdc97	A	T	7: 25,715,776	L154Q	probably damaging	Het
Cd40	T	C	2: 165,063,563		probably null	Het
Celsr1	T	A	15: 85,926,222	N2155I	possibly damaging	Het
Cep57	G	A	9: 13,818,868	H98Y	probably damaging	Het
Chrna7	A	T	7: 63,106,057	L247Q	probably damaging	Het
Cyp2c40	T	A	19: 39,778,030	M374L	probably damaging	Het
Cyp4f13	T	C	17: 32,925,821	D372G	probably damaging	Het
Dazl	C	A	17: 50,281,283	S288I	probably damaging	Het
Dnah5	T	C	15: 28,311,328	F1818L	probably damaging	Het
Echdc1	T	C	10: 29,334,208	V143A	possibly damaging	Het
Eif4enif1	T	A	11: 3,242,687	H838Q	probably damaging	Het
Erich3	A	T	3: 154,763,580	D1223V	probably damaging	Het
Fbxl2	A	G	9: 113,986,508	I229T	possibly damaging	Het
Gfm2	G	A	13: 97,163,151	A406T	probably damaging	Het
Ggnbp2	A	G	11: 84,869,968	M1T	probably null	Het
Glb1l2	C	T	9: 26,796,866		probably benign	Het
Gnl2	A	G	4: 125,052,840	K618R	probably benign	Het
Greb1	A	T	12: 16,716,759	I346K	probably benign	Het
Greb1l	G	A	18: 10,542,427	E1341K	probably damaging	Het
Gtse1	A	G	15: 85,873,792	Q533R	probably benign	Het
Hemgn	A	G	4: 46,403,927	S23P	possibly damaging	Het
Htr6	G	T	4: 139,061,666	H359Q	probably damaging	Het
Ifit1	T	C	19: 34,648,804	F447L	probably benign	Het
Kansl1	T	C	11: 104,424,858	Y118C	possibly damaging	Het
Khk	G	A	5: 30,927,029	V118M	probably benign	Het
Klra17	T	A	6: 129,868,708	K181M	probably damaging	Het
Lbh	T	C	17: 72,921,292		probably null	Het
Lmo2	T	C	2: 103,976,100	I108T	probably damaging	Het
Mgat5	T	A	1: 127,387,514		probably null	Het
Mink1	T	C	11: 70,607,343	V525A	probably benign	Het
Myo10	C	A	15: 25,778,078		probably null	Het
Nlrp2	T	C	7: 5,325,008	N682S	probably benign	Het
Nr2e3	G	A	9: 59,949,334		probably benign	Het
Olfr1415	T	C	1: 92,491,036	T240A	probably damaging	Het
Olfr467	T	C	7: 107,814,964	C129R	probably damaging	Het
Pabpc4l	T	C	3: 46,446,841	T123A	probably benign	Het
Pfas	G	A	11: 68,988,021	S1319F	probably damaging	Het
Phf3	T	C	1: 30,803,806	K2024R	probably damaging	Het
Pld4	G	A	12: 112,768,612	C501Y	probably damaging	Het
Psg16	C	T	7: 17,090,635	R115W	probably damaging	Het
Rab3gap1	G	A	1: 127,942,373		probably null	Het
Rimkla	C	A	4: 119,477,852	K111N	probably damaging	Het
Rrm2b	T	C	15: 37,927,327	E113G	probably damaging	Het
Rspry1	C	T	8: 94,623,185	T67I	probably benign	Het
Skint6	C	A	4: 113,184,768	E292*	probably null	Het
Skint8	C	A	4: 111,950,193	L359M	probably damaging	Het
Slc13a1	A	G	6: 24,134,374	M170T	probably benign	Het
Slc15a5	T	C	6: 138,073,036	N127S	probably benign	Het
Slc39a10	G	A	1: 46,836,125	H6Y	probably damaging	Het
Sugct	A	T	13: 17,252,560	C338*	probably null	Het
Tbk1	A	T	10: 121,556,051	M486K	probably benign	Het
Terf1	A	T	1: 15,805,685	E3V	probably damaging	Het
Thoc5	T	A	11: 4,910,648	Y246N	probably damaging	Het
Tmem167b	G	A	3: 108,562,099		probably benign	Het
Tmem57	T	C	4: 134,837,019		probably benign	Het
Tmtc1	T	A	6: 148,355,412		probably benign	Het
Zfp322a	A	T	13: 23,357,362	M70K	possibly damaging	Het
Zfp979	A	T	4: 147,613,918	H111Q	possibly damaging	Het

Other mutations in Cemip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00781:Cemip	APN	7	83947280	missense	possibly damaging	0.63
IGL01520:Cemip	APN	7	83948622	missense	probably benign	0.27
IGL01646:Cemip	APN	7	83983232	missense	possibly damaging	0.81
IGL02057:Cemip	APN	7	83987453	missense	probably damaging	1.00
IGL02058:Cemip	APN	7	83997292	missense	probably damaging	0.99
IGL02120:Cemip	APN	7	83951563	missense	probably damaging	0.99
IGL02278:Cemip	APN	7	83937438	missense	probably damaging	1.00
IGL02331:Cemip	APN	7	83963984	critical splice donor site	probably null
IGL02366:Cemip	APN	7	83943641	missense	probably benign	0.08
IGL02434:Cemip	APN	7	83955284	missense	probably damaging	0.98
IGL02622:Cemip	APN	7	83964175	missense	probably damaging	1.00
IGL02958:Cemip	APN	7	83975055	missense	probably damaging	0.99
IGL02979:Cemip	APN	7	84003306	splice site	probably benign
IGL03280:Cemip	APN	7	83987330	splice site	probably benign
IGL03400:Cemip	APN	7	83958516	missense	probably damaging	0.96
IGL03134:Cemip	UTSW	7	83999237	missense	probably damaging	1.00
PIT4618001:Cemip	UTSW	7	83943939	missense	probably benign	0.07
R0149:Cemip	UTSW	7	83964010	missense	probably benign
R0212:Cemip	UTSW	7	83973190	missense	probably damaging	0.99
R0361:Cemip	UTSW	7	83964010	missense	probably benign
R0565:Cemip	UTSW	7	83964110	missense	probably damaging	0.99
R0727:Cemip	UTSW	7	83961578	missense	probably benign	0.00
R1342:Cemip	UTSW	7	83944075	nonsense	probably null
R1456:Cemip	UTSW	7	83998510	missense	possibly damaging	0.96
R1526:Cemip	UTSW	7	83951440	missense	probably damaging	1.00
R1676:Cemip	UTSW	7	83964038	missense	possibly damaging	0.77
R1718:Cemip	UTSW	7	83935658	missense	probably benign	0.00
R2234:Cemip	UTSW	7	83998562	missense	probably benign	0.02
R2513:Cemip	UTSW	7	83942025	missense	probably benign	0.11
R3788:Cemip	UTSW	7	83943898	missense	probably damaging	1.00
R3964:Cemip	UTSW	7	83951509	missense	probably benign	0.43
R3966:Cemip	UTSW	7	83951509	missense	probably benign	0.43
R4436:Cemip	UTSW	7	83987429	missense	probably null	0.43
R4584:Cemip	UTSW	7	83958539	missense	probably damaging	1.00
R4601:Cemip	UTSW	7	83951618	missense	probably damaging	0.98
R4717:Cemip	UTSW	7	83947280	missense	probably damaging	0.97
R4767:Cemip	UTSW	7	83973306	missense	probably damaging	1.00
R4822:Cemip	UTSW	7	83973241	missense	probably benign	0.27
R4849:Cemip	UTSW	7	83935737	missense	possibly damaging	0.52
R4910:Cemip	UTSW	7	83997411	missense	probably damaging	1.00
R4911:Cemip	UTSW	7	83983253	missense	probably damaging	1.00
R4922:Cemip	UTSW	7	83947100	intron	probably benign
R4924:Cemip	UTSW	7	83952938	missense	probably damaging	1.00
R5090:Cemip	UTSW	7	83942135	missense	probably damaging	1.00
R5327:Cemip	UTSW	7	83955301	missense	probably damaging	0.99
R5378:Cemip	UTSW	7	83958525	missense	probably damaging	1.00
R5444:Cemip	UTSW	7	83982291	missense	probably damaging	0.98
R5644:Cemip	UTSW	7	83989184	missense	probably benign	0.03
R5688:Cemip	UTSW	7	83961641	missense	probably damaging	1.00
R5714:Cemip	UTSW	7	83975179	missense	probably damaging	1.00
R6170:Cemip	UTSW	7	83947230	missense	possibly damaging	0.89
R6505:Cemip	UTSW	7	83951597	nonsense	probably null
R6713:Cemip	UTSW	7	83943637	missense	probably benign	0.03
R6767:Cemip	UTSW	7	83998624	missense	probably damaging	1.00
R6817:Cemip	UTSW	7	83987992	missense	probably damaging	1.00
R6896:Cemip	UTSW	7	83998576	missense	probably damaging	1.00
R6945:Cemip	UTSW	7	83998547	missense	probably damaging	1.00
R7236:Cemip	UTSW	7	83948804	splice site	probably null
R7410:Cemip	UTSW	7	83952834	missense	probably damaging	1.00
R7483:Cemip	UTSW	7	83998576	missense	probably damaging	0.99
R7734:Cemip	UTSW	7	83957664	nonsense	probably null
R7924:Cemip	UTSW	7	83943715	splice site	probably benign
R7962:Cemip	UTSW	7	84003408	start gained	probably benign
R7988:Cemip	UTSW	7	84003408	start gained	probably benign
R7993:Cemip	UTSW	7	83964175	missense	probably damaging	1.00
R8005:Cemip	UTSW	7	84003408	start gained	probably benign
R8077:Cemip	UTSW	7	84003408	start gained	probably benign
R8130:Cemip	UTSW	7	83947176	missense	probably benign
R8131:Cemip	UTSW	7	84003408	start gained	probably benign
R8172:Cemip	UTSW	7	83997225	missense	probably damaging	1.00
R8220:Cemip	UTSW	7	83947160	missense	probably damaging	1.00
R8345:Cemip	UTSW	7	83942165	critical splice acceptor site	probably null
R8391:Cemip	UTSW	7	83955309	missense	probably damaging	0.99
R8492:Cemip	UTSW	7	83973214	missense	probably damaging	0.99
R8496:Cemip	UTSW	7	83951426	missense	probably benign	0.00
RF008:Cemip	UTSW	7	83961635	missense	probably damaging	0.99
T0970:Cemip	UTSW	7	83983146	missense	probably damaging	0.99
X0067:Cemip	UTSW	7	83947208	missense	probably damaging	0.98
Z1177:Cemip	UTSW	7	83947296	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGCCTTTGAGCACCATGCC -3'
(R):5'- GTACATAGGTCACTGTCTCTTTCAG -3'

Sequencing Primer
(F):5'- AGCACCATGCCTGAGTTTG -3'
(R):5'- TTTCAGACTGCTGCCAAGAC -3'

Posted On

2016-07-22