Incidental Mutation 'R0009:Arih2'
ID40479
Institutional Source Beutler Lab
Gene Symbol Arih2
Ensembl Gene ENSMUSG00000064145
Gene Nameariadne RBR E3 ubiquitin protein ligase 2
SynonymsTRIAD1
MMRRC Submission 038304-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0009 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108602942-108649386 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108611727 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 264 (H264L)
Ref Sequence ENSEMBL: ENSMUSP00000141914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013338] [ENSMUST00000193190] [ENSMUST00000193197] [ENSMUST00000193552]
Predicted Effect probably damaging
Transcript: ENSMUST00000013338
AA Change: H264L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000013338
Gene: ENSMUSG00000064145
AA Change: H264L

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
RING 138 171 1.21e-1 SMART
IBR 207 269 7.29e-23 SMART
ZnF_C2HC 255 271 2.03e0 SMART
IBR 277 339 1.81e-9 SMART
RING 299 339 5.86e-1 SMART
low complexity region 421 432 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192853
Predicted Effect probably damaging
Transcript: ENSMUST00000193190
AA Change: H264L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141914
Gene: ENSMUSG00000064145
AA Change: H264L

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
RING 138 171 5.7e-4 SMART
IBR 207 269 2.5e-25 SMART
ZnF_C2HC 255 271 8.4e-3 SMART
Blast:IBR 277 317 2e-17 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000193197
AA Change: H31L

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141911
Gene: ENSMUSG00000064145
AA Change: H31L

DomainStartEndE-ValueType
IBR 1 36 1.5e-3 SMART
ZnF_C2HC 22 38 8.4e-3 SMART
Blast:IBR 44 79 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000193552
Predicted Effect probably benign
Transcript: ENSMUST00000194073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195741
Meta Mutation Damage Score 0.9746 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase that polyubiquitinates some proteins, tagging them for degradation. The encoded protein upregulates p53 in some cancer cells and may inhibit myelopoiesis. Several transcript variants encoding different isoforms have been found for this gene, although the full-length nature of some of them have not been determined yet. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous inactivation of this gene causes altered dendritic cell physiology, enhanced liver apoptosis, and complete fetal lethality that is partially modified by genetic background. On a mixed genetic background, mice that survive past weaning succumb to a severe multiorgan inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T G 15: 60,919,633 probably benign Het
Abcg4 T G 9: 44,277,649 probably benign Het
Afm C A 5: 90,545,384 probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Aplnr T A 2: 85,137,276 probably null Het
Atp1a1 A T 3: 101,579,835 I886N possibly damaging Het
Bmf A T 2: 118,549,622 V14E probably damaging Het
Ccdc116 T C 16: 17,144,039 E15G probably damaging Het
Ccdc175 T C 12: 72,135,965 N427D possibly damaging Het
Cfap53 A G 18: 74,299,176 H45R probably benign Het
Chd3 A G 11: 69,349,906 L1569P probably damaging Het
Cntn2 G A 1: 132,516,180 Q457* probably null Het
Coro1a A T 7: 126,701,413 probably benign Het
Cracr2b T A 7: 141,463,759 L91Q probably damaging Het
Ctdspl T C 9: 119,020,046 probably null Het
Dip2b T A 15: 100,169,312 L565Q probably damaging Het
Dip2c T A 13: 9,621,903 C1004S probably damaging Het
Dnah11 A T 12: 118,045,522 I2135N possibly damaging Het
Dnah14 A G 1: 181,769,407 probably benign Het
Dnase1 T C 16: 4,038,946 V147A probably damaging Het
Dusp8 T C 7: 142,082,054 probably benign Het
Fer1l6 T C 15: 58,662,787 Y1828H probably damaging Het
Flvcr1 A G 1: 191,008,191 V544A probably benign Het
Fsd1l T C 4: 53,687,209 V311A probably benign Het
Glud1 G A 14: 34,334,268 G300S probably benign Het
Gm4847 C T 1: 166,630,486 V433I probably benign Het
Gstm3 T G 3: 107,967,840 Y62S probably damaging Het
Gtse1 C T 15: 85,862,435 P151S probably benign Het
Herc2 T C 7: 56,207,812 S4048P probably benign Het
Hp1bp3 T A 4: 138,221,683 I19K probably benign Het
Htr7 C A 19: 36,041,540 probably benign Het
Il1a C T 2: 129,309,074 D10N probably damaging Het
Il22ra2 A T 10: 19,624,458 N39I probably damaging Het
Kcnn4 T C 7: 24,379,255 C267R possibly damaging Het
Larp1 A G 11: 58,055,473 K879R possibly damaging Het
Lcn5 T A 2: 25,661,405 probably benign Het
Lep T A 6: 29,068,972 C7* probably null Het
Magi2 A T 5: 20,611,055 Y747F probably benign Het
Mast4 T C 13: 102,742,058 T1223A probably damaging Het
Mcc C T 18: 44,445,933 E803K probably damaging Het
Mtmr4 T C 11: 87,611,508 I796T probably benign Het
Myef2 A T 2: 125,108,978 D312E probably benign Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Myo19 T A 11: 84,888,169 probably null Het
Naa15 T G 3: 51,470,219 H763Q probably damaging Het
Pde5a C T 3: 122,824,902 probably benign Het
Plpp2 C T 10: 79,527,244 R184H probably benign Het
Rab19 T G 6: 39,389,687 L179V probably damaging Het
Rims2 T A 15: 39,534,966 M1087K probably damaging Het
Riox2 C A 16: 59,489,367 D361E probably benign Het
Sh3rf1 T A 8: 61,226,293 V123E probably damaging Het
Slc35e1 A T 8: 72,484,709 N318K probably damaging Het
Slc9a2 A T 1: 40,763,602 E604V probably benign Het
Srp72 T C 5: 76,987,885 S221P probably damaging Het
Tbx19 A T 1: 165,160,520 S15T possibly damaging Het
Tcea2 A G 2: 181,685,817 T112A probably benign Het
Tesk1 T A 4: 43,445,368 D230E probably damaging Het
Tm4sf5 C T 11: 70,510,712 A179V probably damaging Het
Tnr G T 1: 159,852,416 G320V probably damaging Het
Trappc11 A T 8: 47,503,320 C874S possibly damaging Het
Trpm3 T A 19: 22,914,446 Y885N probably damaging Het
Unc5a T A 13: 55,002,879 C505S probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Xpo5 T C 17: 46,204,786 probably benign Het
Zfp637 C A 6: 117,845,668 H252Q probably damaging Het
Zfp646 T A 7: 127,880,731 D693E probably damaging Het
Other mutations in Arih2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Arih2 APN 9 108605410 missense probably damaging 1.00
IGL03213:Arih2 APN 9 108607347 missense probably damaging 1.00
R0009:Arih2 UTSW 9 108611727 missense probably damaging 1.00
R0314:Arih2 UTSW 9 108608679 missense probably damaging 1.00
R0413:Arih2 UTSW 9 108616717 missense probably damaging 0.98
R0450:Arih2 UTSW 9 108605092 missense possibly damaging 0.57
R0469:Arih2 UTSW 9 108605092 missense possibly damaging 0.57
R0865:Arih2 UTSW 9 108649300 utr 5 prime probably benign
R2099:Arih2 UTSW 9 108616738 missense probably damaging 1.00
R2913:Arih2 UTSW 9 108644076 missense probably damaging 1.00
R4383:Arih2 UTSW 9 108644277 start codon destroyed probably benign 0.41
R4636:Arih2 UTSW 9 108613814 missense probably damaging 1.00
R5033:Arih2 UTSW 9 108611660 unclassified probably benign
R5562:Arih2 UTSW 9 108607347 missense probably damaging 1.00
R5976:Arih2 UTSW 9 108607973 makesense probably null
R6248:Arih2 UTSW 9 108611642 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCCGAGCTGCATTACTCAGGAAAG -3'
(R):5'- CCGTCCAAGAGGTTTAAGGAGACAC -3'

Sequencing Primer
(F):5'- TGCATTACTCAGGAAAGATCCAG -3'
(R):5'- GACACTAACTTGTGGGAGTCC -3'
Posted On2013-05-23