Incidental Mutation 'R5310:Cep57'
ID404791
Institutional Source Beutler Lab
Gene Symbol Cep57
Ensembl Gene ENSMUSG00000031922
Gene Namecentrosomal protein 57
Synonyms4931428M20Rik, Tsp57, 3110002L15Rik, 4921510P06Rik
MMRRC Submission 042893-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R5310 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location13807792-13827107 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13818868 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 98 (H98Y)
Ref Sequence ENSEMBL: ENSMUSP00000114665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034398] [ENSMUST00000124883] [ENSMUST00000134746] [ENSMUST00000142494] [ENSMUST00000144484] [ENSMUST00000147115] [ENSMUST00000148086] [ENSMUST00000150893]
Predicted Effect probably damaging
Transcript: ENSMUST00000034398
AA Change: H125Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034398
Gene: ENSMUSG00000031922
AA Change: H125Y

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Cep57_CLD 68 245 9.8e-67 PFAM
low complexity region 259 271 N/A INTRINSIC
Pfam:Cep57_MT_bd 348 420 2.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124524
Predicted Effect probably benign
Transcript: ENSMUST00000124883
SMART Domains Protein: ENSMUSP00000119081
Gene: ENSMUSG00000031922

DomainStartEndE-ValueType
Pfam:Cep57_CLD 1 96 4.7e-34 PFAM
low complexity region 110 122 N/A INTRINSIC
Pfam:Cep57_MT_bd 196 271 4e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000134746
AA Change: H125Y

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116713
Gene: ENSMUSG00000031922
AA Change: H125Y

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Cep57_CLD 68 209 1e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000142494
AA Change: H125Y

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114749
Gene: ENSMUSG00000031922
AA Change: H125Y

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Cep57_CLD 68 245 3.3e-72 PFAM
low complexity region 259 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144484
SMART Domains Protein: ENSMUSP00000114940
Gene: ENSMUSG00000031922

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147115
AA Change: H125Y

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116931
Gene: ENSMUSG00000031922
AA Change: H125Y

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Cep57_CLD 68 245 2.1e-72 PFAM
low complexity region 254 275 N/A INTRINSIC
Pfam:Cep57_MT_bd 319 394 1.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148086
AA Change: H98Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114665
Gene: ENSMUSG00000031922
AA Change: H98Y

DomainStartEndE-ValueType
Pfam:Cep57_CLD 41 218 1e-71 PFAM
low complexity region 232 244 N/A INTRINSIC
Pfam:Cep57_MT_bd 318 393 6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148904
Predicted Effect probably benign
Transcript: ENSMUST00000150893
SMART Domains Protein: ENSMUSP00000115338
Gene: ENSMUSG00000031922

DomainStartEndE-ValueType
Pfam:Cep57_CLD 1 96 5.2e-37 PFAM
low complexity region 110 122 N/A INTRINSIC
Pfam:Cep57_MT_bd 196 271 2.6e-24 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000151878
AA Change: H14Y
SMART Domains Protein: ENSMUSP00000116847
Gene: ENSMUSG00000031922
AA Change: H14Y

DomainStartEndE-ValueType
Pfam:Cep57_CLD 1 133 1.6e-43 PFAM
low complexity region 147 159 N/A INTRINSIC
Meta Mutation Damage Score 0.0744 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.7%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein called Translokin. This protein localizes to the centrosome and has a function in microtubular stabilization. The N-terminal half of this protein is required for its centrosome localization and for its multimerization, and the C-terminal half is required for nucleating, bundling and anchoring microtubules to the centrosomes. This protein specifically interacts with fibroblast growth factor 2 (FGF2), sorting nexin 6, Ran-binding protein M and the kinesins KIF3A and KIF3B, and thus mediates the nuclear translocation and mitogenic activity of the FGF2. It also interacts with cyclin D1 and controls nucleocytoplasmic distribution of the cyclin D1 in quiescent cells. This protein is crucial for maintaining correct chromosomal number during cell division. Mutations in this gene cause mosaic variegated aneuploidy syndrome, a rare autosomal recessive disorder. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A C 1: 26,685,088 V337G probably benign Het
Abca15 A T 7: 120,332,616 I31L possibly damaging Het
Abca17 T C 17: 24,281,230 K1329R probably benign Het
Acap2 A G 16: 31,133,609 Y197H probably benign Het
Adgrv1 A G 13: 81,476,690 V3720A possibly damaging Het
Alms1 T A 6: 85,615,368 S870T possibly damaging Het
Anapc4 A G 5: 52,859,159 E493G probably benign Het
Ap2a1 A G 7: 44,906,065 probably null Het
Arhgef38 A G 3: 133,116,466 L179P probably damaging Het
Bicral T C 17: 46,813,983 D630G possibly damaging Het
Ccdc97 A T 7: 25,715,776 L154Q probably damaging Het
Cd40 T C 2: 165,063,563 probably null Het
Celsr1 T A 15: 85,926,222 N2155I possibly damaging Het
Cemip A T 7: 83,992,033 L261H probably damaging Het
Chrna7 A T 7: 63,106,057 L247Q probably damaging Het
Cyp2c40 T A 19: 39,778,030 M374L probably damaging Het
Cyp4f13 T C 17: 32,925,821 D372G probably damaging Het
Dazl C A 17: 50,281,283 S288I probably damaging Het
Dnah5 T C 15: 28,311,328 F1818L probably damaging Het
Echdc1 T C 10: 29,334,208 V143A possibly damaging Het
Eif4enif1 T A 11: 3,242,687 H838Q probably damaging Het
Erich3 A T 3: 154,763,580 D1223V probably damaging Het
Fbxl2 A G 9: 113,986,508 I229T possibly damaging Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Ggnbp2 A G 11: 84,869,968 M1T probably null Het
Glb1l2 C T 9: 26,796,866 probably benign Het
Gnl2 A G 4: 125,052,840 K618R probably benign Het
Greb1 A T 12: 16,716,759 I346K probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Gtse1 A G 15: 85,873,792 Q533R probably benign Het
Hemgn A G 4: 46,403,927 S23P possibly damaging Het
Htr6 G T 4: 139,061,666 H359Q probably damaging Het
Ifit1 T C 19: 34,648,804 F447L probably benign Het
Kansl1 T C 11: 104,424,858 Y118C possibly damaging Het
Khk G A 5: 30,927,029 V118M probably benign Het
Klra17 T A 6: 129,868,708 K181M probably damaging Het
Lbh T C 17: 72,921,292 probably null Het
Lmo2 T C 2: 103,976,100 I108T probably damaging Het
Mgat5 T A 1: 127,387,514 probably null Het
Mink1 T C 11: 70,607,343 V525A probably benign Het
Myo10 C A 15: 25,778,078 probably null Het
Nlrp2 T C 7: 5,325,008 N682S probably benign Het
Nr2e3 G A 9: 59,949,334 probably benign Het
Olfr1415 T C 1: 92,491,036 T240A probably damaging Het
Olfr467 T C 7: 107,814,964 C129R probably damaging Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pfas G A 11: 68,988,021 S1319F probably damaging Het
Phf3 T C 1: 30,803,806 K2024R probably damaging Het
Pld4 G A 12: 112,768,612 C501Y probably damaging Het
Psg16 C T 7: 17,090,635 R115W probably damaging Het
Rab3gap1 G A 1: 127,942,373 probably null Het
Rimkla C A 4: 119,477,852 K111N probably damaging Het
Rrm2b T C 15: 37,927,327 E113G probably damaging Het
Rspry1 C T 8: 94,623,185 T67I probably benign Het
Skint6 C A 4: 113,184,768 E292* probably null Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc13a1 A G 6: 24,134,374 M170T probably benign Het
Slc15a5 T C 6: 138,073,036 N127S probably benign Het
Slc39a10 G A 1: 46,836,125 H6Y probably damaging Het
Sugct A T 13: 17,252,560 C338* probably null Het
Tbk1 A T 10: 121,556,051 M486K probably benign Het
Terf1 A T 1: 15,805,685 E3V probably damaging Het
Thoc5 T A 11: 4,910,648 Y246N probably damaging Het
Tmem167b G A 3: 108,562,099 probably benign Het
Tmem57 T C 4: 134,837,019 probably benign Het
Tmtc1 T A 6: 148,355,412 probably benign Het
Zfp322a A T 13: 23,357,362 M70K possibly damaging Het
Zfp979 A T 4: 147,613,918 H111Q possibly damaging Het
Other mutations in Cep57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Cep57 APN 9 13819016 missense probably damaging 1.00
IGL01712:Cep57 APN 9 13813417 missense possibly damaging 0.72
IGL01965:Cep57 APN 9 13821520 unclassified probably benign
IGL02250:Cep57 APN 9 13810643 missense probably damaging 1.00
IGL02378:Cep57 APN 9 13821546 nonsense probably null
IGL02943:Cep57 APN 9 13818853 splice site probably benign
IGL03244:Cep57 APN 9 13818387 nonsense probably null
R0082:Cep57 UTSW 9 13810876 unclassified probably benign
R0330:Cep57 UTSW 9 13816985 missense probably damaging 1.00
R0786:Cep57 UTSW 9 13809870 missense probably damaging 0.99
R0962:Cep57 UTSW 9 13808743 missense possibly damaging 0.48
R1037:Cep57 UTSW 9 13818979 missense possibly damaging 0.89
R1472:Cep57 UTSW 9 13821554 missense probably benign 0.03
R1773:Cep57 UTSW 9 13816068 missense probably damaging 1.00
R1776:Cep57 UTSW 9 13818874 missense probably damaging 0.99
R4162:Cep57 UTSW 9 13812633 splice site probably null
R4895:Cep57 UTSW 9 13816153 intron probably benign
R4942:Cep57 UTSW 9 13813427 missense probably damaging 0.96
R5566:Cep57 UTSW 9 13821575 missense probably damaging 0.99
R5996:Cep57 UTSW 9 13809879 missense probably damaging 0.99
R6058:Cep57 UTSW 9 13810761 missense possibly damaging 0.75
R7065:Cep57 UTSW 9 13818381 missense probably damaging 1.00
R7410:Cep57 UTSW 9 13818684 intron probably benign
R7421:Cep57 UTSW 9 13810673 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TACTTGCGTCAAATATGCCACAC -3'
(R):5'- AGCTAACTTAAGGTGCGGTATG -3'

Sequencing Primer
(F):5'- CACTGCCAGTAAGCACTATGC -3'
(R):5'- CGGTATGCTTTTTATATTTGTCAGCC -3'
Posted On2016-07-22