Incidental Mutation 'R5310:Tbk1'
ID404796
Institutional Source Beutler Lab
Gene Symbol Tbk1
Ensembl Gene ENSMUSG00000020115
Gene NameTANK-binding kinase 1
Synonyms1200008B05Rik
MMRRC Submission 042893-MU
Accession Numbers

MGI: 1929658

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5310 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location121546455-121586787 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121556051 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 486 (M486K)
Ref Sequence ENSEMBL: ENSMUSP00000020316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020316] [ENSMUST00000219400]
PDB Structure
Crystal structure of mouse TBK1 bound to BX795 [X-RAY DIFFRACTION]
Crystal structure of mouse TBK1 bound to SU6668 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000020316
AA Change: M486K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000020316
Gene: ENSMUSG00000020115
AA Change: M486K

DomainStartEndE-ValueType
Pfam:Pkinase 9 300 2.6e-46 PFAM
Pfam:Pkinase_Tyr 10 250 1.5e-27 PFAM
low complexity region 355 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220386
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.7%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NF-kappa-B (NFKB) complex of proteins is inhibited by I-kappa-B (IKB) proteins, which inactivate NFKB by trapping it in the cytoplasm. Phosphorylation of serine residues on the IKB proteins by IKB kinases marks them for destruction via the ubiquitination pathway, thereby allowing activation and nuclear translocation of the NFKB complex. The protein encoded by this gene is similar to IKB kinases and can mediate NFKB activation in response to certain growth factors. [provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality. Mice homozygous for a different knock-out allele exhibit increased prenatal lethality, increased infiltration of mononuclear and/or granulomatous cells in multiple organs and tissues at 3 months of age, and increased lethality in response to LPS. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted(5) Gene trapped(18)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A C 1: 26,685,088 V337G probably benign Het
Abca15 A T 7: 120,332,616 I31L possibly damaging Het
Abca17 T C 17: 24,281,230 K1329R probably benign Het
Acap2 A G 16: 31,133,609 Y197H probably benign Het
Adgrv1 A G 13: 81,476,690 V3720A possibly damaging Het
Alms1 T A 6: 85,615,368 S870T possibly damaging Het
Anapc4 A G 5: 52,859,159 E493G probably benign Het
Ap2a1 A G 7: 44,906,065 probably null Het
Arhgef38 A G 3: 133,116,466 L179P probably damaging Het
Bicral T C 17: 46,813,983 D630G possibly damaging Het
Ccdc97 A T 7: 25,715,776 L154Q probably damaging Het
Cd40 T C 2: 165,063,563 probably null Het
Celsr1 T A 15: 85,926,222 N2155I possibly damaging Het
Cemip A T 7: 83,992,033 L261H probably damaging Het
Cep57 G A 9: 13,818,868 H98Y probably damaging Het
Chrna7 A T 7: 63,106,057 L247Q probably damaging Het
Cyp2c40 T A 19: 39,778,030 M374L probably damaging Het
Cyp4f13 T C 17: 32,925,821 D372G probably damaging Het
Dazl C A 17: 50,281,283 S288I probably damaging Het
Dnah5 T C 15: 28,311,328 F1818L probably damaging Het
Echdc1 T C 10: 29,334,208 V143A possibly damaging Het
Eif4enif1 T A 11: 3,242,687 H838Q probably damaging Het
Erich3 A T 3: 154,763,580 D1223V probably damaging Het
Fbxl2 A G 9: 113,986,508 I229T possibly damaging Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Ggnbp2 A G 11: 84,869,968 M1T probably null Het
Glb1l2 C T 9: 26,796,866 probably benign Het
Gnl2 A G 4: 125,052,840 K618R probably benign Het
Greb1 A T 12: 16,716,759 I346K probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Gtse1 A G 15: 85,873,792 Q533R probably benign Het
Hemgn A G 4: 46,403,927 S23P possibly damaging Het
Htr6 G T 4: 139,061,666 H359Q probably damaging Het
Ifit1 T C 19: 34,648,804 F447L probably benign Het
Kansl1 T C 11: 104,424,858 Y118C possibly damaging Het
Khk G A 5: 30,927,029 V118M probably benign Het
Klra17 T A 6: 129,868,708 K181M probably damaging Het
Lbh T C 17: 72,921,292 probably null Het
Lmo2 T C 2: 103,976,100 I108T probably damaging Het
Mgat5 T A 1: 127,387,514 probably null Het
Mink1 T C 11: 70,607,343 V525A probably benign Het
Myo10 C A 15: 25,778,078 probably null Het
Nlrp2 T C 7: 5,325,008 N682S probably benign Het
Nr2e3 G A 9: 59,949,334 probably benign Het
Olfr1415 T C 1: 92,491,036 T240A probably damaging Het
Olfr467 T C 7: 107,814,964 C129R probably damaging Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pfas G A 11: 68,988,021 S1319F probably damaging Het
Phf3 T C 1: 30,803,806 K2024R probably damaging Het
Pld4 G A 12: 112,768,612 C501Y probably damaging Het
Psg16 C T 7: 17,090,635 R115W probably damaging Het
Rab3gap1 G A 1: 127,942,373 probably null Het
Rimkla C A 4: 119,477,852 K111N probably damaging Het
Rrm2b T C 15: 37,927,327 E113G probably damaging Het
Rspry1 C T 8: 94,623,185 T67I probably benign Het
Skint6 C A 4: 113,184,768 E292* probably null Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc13a1 A G 6: 24,134,374 M170T probably benign Het
Slc15a5 T C 6: 138,073,036 N127S probably benign Het
Slc39a10 G A 1: 46,836,125 H6Y probably damaging Het
Sugct A T 13: 17,252,560 C338* probably null Het
Terf1 A T 1: 15,805,685 E3V probably damaging Het
Thoc5 T A 11: 4,910,648 Y246N probably damaging Het
Tmem167b G A 3: 108,562,099 probably benign Het
Tmem57 T C 4: 134,837,019 probably benign Het
Tmtc1 T A 6: 148,355,412 probably benign Het
Zfp322a A T 13: 23,357,362 M70K possibly damaging Het
Zfp979 A T 4: 147,613,918 H111Q possibly damaging Het
Other mutations in Tbk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Tbk1 APN 10 121552250 missense probably benign 0.00
IGL01021:Tbk1 APN 10 121551272 missense probably benign 0.07
IGL01371:Tbk1 APN 10 121559871 missense probably benign 0.09
IGL01383:Tbk1 APN 10 121576279 missense probably damaging 1.00
IGL01583:Tbk1 APN 10 121557229 missense probably benign
IGL01734:Tbk1 APN 10 121571983 nonsense probably null
IGL02068:Tbk1 APN 10 121570789 missense probably damaging 1.00
IGL02676:Tbk1 APN 10 121568080 missense possibly damaging 0.82
IGL02737:Tbk1 APN 10 121559862 missense probably null 0.96
IGL03334:Tbk1 APN 10 121584199 missense possibly damaging 0.79
pioneer UTSW 10 121578690 missense probably damaging 1.00
trailblazer UTSW 10 121570685 missense probably damaging 1.00
R0030:Tbk1 UTSW 10 121561624 missense probably benign 0.09
R0386:Tbk1 UTSW 10 121584254 missense probably damaging 0.96
R1396:Tbk1 UTSW 10 121571916 missense probably damaging 1.00
R1430:Tbk1 UTSW 10 121559934 missense probably benign
R1522:Tbk1 UTSW 10 121551318 missense probably benign 0.06
R1542:Tbk1 UTSW 10 121559935 missense probably benign
R1717:Tbk1 UTSW 10 121561645 missense probably benign 0.10
R1860:Tbk1 UTSW 10 121547171 missense probably benign 0.01
R2188:Tbk1 UTSW 10 121563931 nonsense probably null
R2519:Tbk1 UTSW 10 121557259 missense probably benign 0.03
R4627:Tbk1 UTSW 10 121568080 missense possibly damaging 0.82
R4945:Tbk1 UTSW 10 121551269 missense probably damaging 0.98
R5061:Tbk1 UTSW 10 121576336 missense possibly damaging 0.62
R5256:Tbk1 UTSW 10 121570685 missense probably damaging 1.00
R6187:Tbk1 UTSW 10 121584243 missense probably benign 0.02
R6425:Tbk1 UTSW 10 121563962 missense probably benign 0.00
R6512:Tbk1 UTSW 10 121578621 missense probably damaging 1.00
R6897:Tbk1 UTSW 10 121559877 missense probably benign 0.00
R7268:Tbk1 UTSW 10 121552499 missense probably benign 0.03
X0022:Tbk1 UTSW 10 121560293 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGACTCTTTCTCCAGGGAGC -3'
(R):5'- TCATCAGCCCATACCTGCAG -3'

Sequencing Primer
(F):5'- TCTCCAGGGAGCTTTAGTGACAC -3'
(R):5'- GGCAGTGCAGGAAGTTCC -3'
Posted On2016-07-22