Incidental Mutation 'R5310:Ggnbp2'
ID404800
Institutional Source Beutler Lab
Gene Symbol Ggnbp2
Ensembl Gene ENSMUSG00000020530
Gene Namegametogenetin binding protein 2
SynonymsZfp403, DIF-3, D330017P12Rik
MMRRC Submission 042893-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R5310 (G1)
Quality Score166
Status Validated
Chromosome11
Chromosomal Location84832361-84870817 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 84869968 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000127584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018547] [ENSMUST00000100686] [ENSMUST00000108081] [ENSMUST00000154915] [ENSMUST00000166425] [ENSMUST00000168434] [ENSMUST00000170741] [ENSMUST00000172405]
Predicted Effect probably null
Transcript: ENSMUST00000018547
AA Change: M1T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018547
Gene: ENSMUSG00000020530
AA Change: M1T

DomainStartEndE-ValueType
low complexity region 179 185 N/A INTRINSIC
coiled coil region 393 426 N/A INTRINSIC
low complexity region 570 584 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100686
AA Change: M1T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098252
Gene: ENSMUSG00000020530
AA Change: M1T

DomainStartEndE-ValueType
coiled coil region 351 388 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108081
AA Change: M1T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103716
Gene: ENSMUSG00000020530
AA Change: M1T

DomainStartEndE-ValueType
coiled coil region 353 386 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000154915
AA Change: M1T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117482
Gene: ENSMUSG00000020530
AA Change: M1T

DomainStartEndE-ValueType
coiled coil region 351 384 N/A INTRINSIC
low complexity region 528 542 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166425
AA Change: M1T

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167429
Predicted Effect probably null
Transcript: ENSMUST00000168434
AA Change: M1T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130013
Gene: ENSMUSG00000020530
AA Change: M1T

DomainStartEndE-ValueType
coiled coil region 351 384 N/A INTRINSIC
low complexity region 528 542 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170741
SMART Domains Protein: ENSMUSP00000128109
Gene: ENSMUSG00000020530

DomainStartEndE-ValueType
low complexity region 99 113 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172405
AA Change: M1T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127584
Gene: ENSMUSG00000020530
AA Change: M1T

DomainStartEndE-ValueType
coiled coil region 353 386 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
Meta Mutation Damage Score 0.9581 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.7%
Validation Efficiency 100% (74/74)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit lethality throughout fetal growth and development associated with pallor and alterations in placental labyrinth vasculature morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A C 1: 26,685,088 V337G probably benign Het
Abca15 A T 7: 120,332,616 I31L possibly damaging Het
Abca17 T C 17: 24,281,230 K1329R probably benign Het
Acap2 A G 16: 31,133,609 Y197H probably benign Het
Adgrv1 A G 13: 81,476,690 V3720A possibly damaging Het
Alms1 T A 6: 85,615,368 S870T possibly damaging Het
Anapc4 A G 5: 52,859,159 E493G probably benign Het
Ap2a1 A G 7: 44,906,065 probably null Het
Arhgef38 A G 3: 133,116,466 L179P probably damaging Het
Bicral T C 17: 46,813,983 D630G possibly damaging Het
Ccdc97 A T 7: 25,715,776 L154Q probably damaging Het
Cd40 T C 2: 165,063,563 probably null Het
Celsr1 T A 15: 85,926,222 N2155I possibly damaging Het
Cemip A T 7: 83,992,033 L261H probably damaging Het
Cep57 G A 9: 13,818,868 H98Y probably damaging Het
Chrna7 A T 7: 63,106,057 L247Q probably damaging Het
Cyp2c40 T A 19: 39,778,030 M374L probably damaging Het
Cyp4f13 T C 17: 32,925,821 D372G probably damaging Het
Dazl C A 17: 50,281,283 S288I probably damaging Het
Dnah5 T C 15: 28,311,328 F1818L probably damaging Het
Echdc1 T C 10: 29,334,208 V143A possibly damaging Het
Eif4enif1 T A 11: 3,242,687 H838Q probably damaging Het
Erich3 A T 3: 154,763,580 D1223V probably damaging Het
Fbxl2 A G 9: 113,986,508 I229T possibly damaging Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Glb1l2 C T 9: 26,796,866 probably benign Het
Gnl2 A G 4: 125,052,840 K618R probably benign Het
Greb1 A T 12: 16,716,759 I346K probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Gtse1 A G 15: 85,873,792 Q533R probably benign Het
Hemgn A G 4: 46,403,927 S23P possibly damaging Het
Htr6 G T 4: 139,061,666 H359Q probably damaging Het
Ifit1 T C 19: 34,648,804 F447L probably benign Het
Kansl1 T C 11: 104,424,858 Y118C possibly damaging Het
Khk G A 5: 30,927,029 V118M probably benign Het
Klra17 T A 6: 129,868,708 K181M probably damaging Het
Lbh T C 17: 72,921,292 probably null Het
Lmo2 T C 2: 103,976,100 I108T probably damaging Het
Mgat5 T A 1: 127,387,514 probably null Het
Mink1 T C 11: 70,607,343 V525A probably benign Het
Myo10 C A 15: 25,778,078 probably null Het
Nlrp2 T C 7: 5,325,008 N682S probably benign Het
Nr2e3 G A 9: 59,949,334 probably benign Het
Olfr1415 T C 1: 92,491,036 T240A probably damaging Het
Olfr467 T C 7: 107,814,964 C129R probably damaging Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pfas G A 11: 68,988,021 S1319F probably damaging Het
Phf3 T C 1: 30,803,806 K2024R probably damaging Het
Pld4 G A 12: 112,768,612 C501Y probably damaging Het
Psg16 C T 7: 17,090,635 R115W probably damaging Het
Rab3gap1 G A 1: 127,942,373 probably null Het
Rimkla C A 4: 119,477,852 K111N probably damaging Het
Rrm2b T C 15: 37,927,327 E113G probably damaging Het
Rspry1 C T 8: 94,623,185 T67I probably benign Het
Skint6 C A 4: 113,184,768 E292* probably null Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc13a1 A G 6: 24,134,374 M170T probably benign Het
Slc15a5 T C 6: 138,073,036 N127S probably benign Het
Slc39a10 G A 1: 46,836,125 H6Y probably damaging Het
Sugct A T 13: 17,252,560 C338* probably null Het
Tbk1 A T 10: 121,556,051 M486K probably benign Het
Terf1 A T 1: 15,805,685 E3V probably damaging Het
Thoc5 T A 11: 4,910,648 Y246N probably damaging Het
Tmem167b G A 3: 108,562,099 probably benign Het
Tmem57 T C 4: 134,837,019 probably benign Het
Tmtc1 T A 6: 148,355,412 probably benign Het
Zfp322a A T 13: 23,357,362 M70K possibly damaging Het
Zfp979 A T 4: 147,613,918 H111Q possibly damaging Het
Other mutations in Ggnbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Ggnbp2 APN 11 84840404 missense possibly damaging 0.49
IGL02095:Ggnbp2 APN 11 84833128 missense probably damaging 1.00
IGL02366:Ggnbp2 APN 11 84841601 missense probably damaging 1.00
IGL02548:Ggnbp2 APN 11 84862286 missense possibly damaging 0.78
R0211:Ggnbp2 UTSW 11 84840313 missense probably damaging 1.00
R0211:Ggnbp2 UTSW 11 84840313 missense probably damaging 1.00
R0375:Ggnbp2 UTSW 11 84836374 nonsense probably null
R0415:Ggnbp2 UTSW 11 84833225 splice site probably benign
R0433:Ggnbp2 UTSW 11 84836420 missense probably damaging 1.00
R0589:Ggnbp2 UTSW 11 84836451 missense probably damaging 1.00
R0970:Ggnbp2 UTSW 11 84862312 missense possibly damaging 0.83
R1413:Ggnbp2 UTSW 11 84833129 missense probably damaging 1.00
R1912:Ggnbp2 UTSW 11 84862296 missense probably benign 0.02
R1997:Ggnbp2 UTSW 11 84860561 missense probably damaging 1.00
R2161:Ggnbp2 UTSW 11 84834433 missense probably benign 0.08
R2220:Ggnbp2 UTSW 11 84836613 missense possibly damaging 0.46
R2879:Ggnbp2 UTSW 11 84832971 unclassified probably null
R2941:Ggnbp2 UTSW 11 84841581 missense probably damaging 1.00
R3726:Ggnbp2 UTSW 11 84854094 missense possibly damaging 0.93
R4662:Ggnbp2 UTSW 11 84862246 missense probably damaging 1.00
R4771:Ggnbp2 UTSW 11 84834488 missense probably benign 0.00
R5212:Ggnbp2 UTSW 11 84854021 intron probably benign
R5479:Ggnbp2 UTSW 11 84854343 missense probably benign
R5924:Ggnbp2 UTSW 11 84858537 missense possibly damaging 0.61
R6212:Ggnbp2 UTSW 11 84836677 missense possibly damaging 0.94
R6700:Ggnbp2 UTSW 11 84840105 missense probably damaging 1.00
R6931:Ggnbp2 UTSW 11 84833167 missense probably damaging 1.00
R7031:Ggnbp2 UTSW 11 84860641 missense probably damaging 1.00
R7493:Ggnbp2 UTSW 11 84854073 missense probably benign 0.21
R7694:Ggnbp2 UTSW 11 84860713 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AAACAGCGTCTCAAAGGCAG -3'
(R):5'- TTTCACCCGTGGCGAATGTG -3'

Sequencing Primer
(F):5'- AGGAGTTGCAACACACTCTTTC -3'
(R):5'- GGCGAATGTGCTGCGAG -3'
Posted On2016-07-22