Incidental Mutation 'R0009:Il22ra2'
ID 40482
Institutional Source Beutler Lab
Gene Symbol Il22ra2
Ensembl Gene ENSMUSG00000039760
Gene Name interleukin 22 receptor, alpha 2
Synonyms Il-22bp
MMRRC Submission 038304-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0009 (G1)
Quality Score 221
Status Validated
Chromosome 10
Chromosomal Location 19497776-19510429 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 19500206 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 39 (N39I)
Ref Sequence ENSEMBL: ENSMUSP00000042642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036564]
AlphaFold Q80XF5
Predicted Effect probably damaging
Transcript: ENSMUST00000036564
AA Change: N39I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042642
Gene: ENSMUSG00000039760
AA Change: N39I

DomainStartEndE-ValueType
Pfam:Tissue_fac 6 113 3.4e-37 PFAM
Pfam:Interfer-bind 125 230 1.4e-26 PFAM
Meta Mutation Damage Score 0.8924 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the class II cytokine receptor family. The encoded soluble protein specifically binds to and inhibits interleukin 22 activity by blocking the interaction of interleukin 22 with its cell surface receptor. The encoded protein may be important in the regulation of inflammatory response, and has been implicated in the regulation of tumorigenesis in the colon. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation display accelerated tumor formation in a colitis associated colon cancer model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T G 15: 60,791,482 (GRCm39) probably benign Het
Abcg4 T G 9: 44,188,946 (GRCm39) probably benign Het
Afm C A 5: 90,693,243 (GRCm39) probably benign Het
Ahrr G A 13: 74,431,143 (GRCm39) probably benign Het
Aplnr T A 2: 84,967,620 (GRCm39) probably null Het
Arih2 T A 9: 108,488,926 (GRCm39) H264L probably damaging Het
Atp1a1 A T 3: 101,487,151 (GRCm39) I886N possibly damaging Het
Bmf A T 2: 118,380,103 (GRCm39) V14E probably damaging Het
Ccdc116 T C 16: 16,961,903 (GRCm39) E15G probably damaging Het
Ccdc175 T C 12: 72,182,739 (GRCm39) N427D possibly damaging Het
Cfap53 A G 18: 74,432,247 (GRCm39) H45R probably benign Het
Chd3 A G 11: 69,240,732 (GRCm39) L1569P probably damaging Het
Cntn2 G A 1: 132,443,918 (GRCm39) Q457* probably null Het
Coro1a A T 7: 126,300,585 (GRCm39) probably benign Het
Cracr2b T A 7: 141,043,672 (GRCm39) L91Q probably damaging Het
Ctdspl T C 9: 118,849,114 (GRCm39) probably null Het
Dip2b T A 15: 100,067,193 (GRCm39) L565Q probably damaging Het
Dip2c T A 13: 9,671,939 (GRCm39) C1004S probably damaging Het
Dnah11 A T 12: 118,009,257 (GRCm39) I2135N possibly damaging Het
Dnah14 A G 1: 181,596,972 (GRCm39) probably benign Het
Dnase1 T C 16: 3,856,810 (GRCm39) V147A probably damaging Het
Dusp8 T C 7: 141,635,791 (GRCm39) probably benign Het
Fer1l6 T C 15: 58,534,636 (GRCm39) Y1828H probably damaging Het
Flvcr1 A G 1: 190,740,388 (GRCm39) V544A probably benign Het
Fsd1l T C 4: 53,687,209 (GRCm39) V311A probably benign Het
Glud1 G A 14: 34,056,225 (GRCm39) G300S probably benign Het
Gm4847 C T 1: 166,458,055 (GRCm39) V433I probably benign Het
Gstm3 T G 3: 107,875,156 (GRCm39) Y62S probably damaging Het
Gtse1 C T 15: 85,746,636 (GRCm39) P151S probably benign Het
Herc2 T C 7: 55,857,560 (GRCm39) S4048P probably benign Het
Hp1bp3 T A 4: 137,948,994 (GRCm39) I19K probably benign Het
Htr7 C A 19: 36,018,940 (GRCm39) probably benign Het
Il1a C T 2: 129,150,994 (GRCm39) D10N probably damaging Het
Kcnn4 T C 7: 24,078,680 (GRCm39) C267R possibly damaging Het
Larp1 A G 11: 57,946,299 (GRCm39) K879R possibly damaging Het
Lcn5 T A 2: 25,551,417 (GRCm39) probably benign Het
Lep T A 6: 29,068,971 (GRCm39) C7* probably null Het
Magi2 A T 5: 20,816,053 (GRCm39) Y747F probably benign Het
Mast4 T C 13: 102,878,566 (GRCm39) T1223A probably damaging Het
Mcc C T 18: 44,579,000 (GRCm39) E803K probably damaging Het
Mtmr4 T C 11: 87,502,334 (GRCm39) I796T probably benign Het
Myef2 A T 2: 124,950,898 (GRCm39) D312E probably benign Het
Myl3 A C 9: 110,596,997 (GRCm39) D119A probably damaging Het
Myo19 T A 11: 84,778,995 (GRCm39) probably null Het
Naa15 T G 3: 51,377,640 (GRCm39) H763Q probably damaging Het
Pde5a C T 3: 122,618,551 (GRCm39) probably benign Het
Plpp2 C T 10: 79,363,078 (GRCm39) R184H probably benign Het
Rab19 T G 6: 39,366,621 (GRCm39) L179V probably damaging Het
Rims2 T A 15: 39,398,362 (GRCm39) M1087K probably damaging Het
Riox2 C A 16: 59,309,730 (GRCm39) D361E probably benign Het
Sh3rf1 T A 8: 61,679,327 (GRCm39) V123E probably damaging Het
Slc35e1 A T 8: 73,238,553 (GRCm39) N318K probably damaging Het
Slc9a2 A T 1: 40,802,762 (GRCm39) E604V probably benign Het
Srp72 T C 5: 77,135,732 (GRCm39) S221P probably damaging Het
Tbx19 A T 1: 164,988,089 (GRCm39) S15T possibly damaging Het
Tcea2 A G 2: 181,327,610 (GRCm39) T112A probably benign Het
Tesk1 T A 4: 43,445,368 (GRCm39) D230E probably damaging Het
Tm4sf5 C T 11: 70,401,538 (GRCm39) A179V probably damaging Het
Tnr G T 1: 159,679,986 (GRCm39) G320V probably damaging Het
Trappc11 A T 8: 47,956,355 (GRCm39) C874S possibly damaging Het
Trpm3 T A 19: 22,891,810 (GRCm39) Y885N probably damaging Het
Unc5a T A 13: 55,150,692 (GRCm39) C505S probably damaging Het
Vmn1r28 G A 6: 58,242,702 (GRCm39) A182T probably benign Het
Xpo5 T C 17: 46,515,712 (GRCm39) probably benign Het
Zfp637 C A 6: 117,822,629 (GRCm39) H252Q probably damaging Het
Zfp646 T A 7: 127,479,903 (GRCm39) D693E probably damaging Het
Other mutations in Il22ra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02572:Il22ra2 APN 10 19,502,492 (GRCm39) missense probably benign 0.04
IGL02835:Il22ra2 UTSW 10 19,502,424 (GRCm39) missense probably benign 0.04
R0009:Il22ra2 UTSW 10 19,500,206 (GRCm39) missense probably damaging 1.00
R1687:Il22ra2 UTSW 10 19,508,620 (GRCm39) missense probably benign 0.09
R1802:Il22ra2 UTSW 10 19,502,447 (GRCm39) missense probably damaging 0.98
R2138:Il22ra2 UTSW 10 19,508,618 (GRCm39) missense probably benign 0.00
R2139:Il22ra2 UTSW 10 19,508,618 (GRCm39) missense probably benign 0.00
R3936:Il22ra2 UTSW 10 19,507,456 (GRCm39) missense probably benign 0.00
R4063:Il22ra2 UTSW 10 19,502,400 (GRCm39) missense possibly damaging 0.88
R4559:Il22ra2 UTSW 10 19,502,460 (GRCm39) missense possibly damaging 0.90
R7578:Il22ra2 UTSW 10 19,507,372 (GRCm39) missense probably benign 0.10
R7661:Il22ra2 UTSW 10 19,497,826 (GRCm39) missense probably benign 0.01
R8720:Il22ra2 UTSW 10 19,508,599 (GRCm39) missense probably damaging 1.00
R8897:Il22ra2 UTSW 10 19,507,401 (GRCm39) missense probably damaging 0.99
R9483:Il22ra2 UTSW 10 19,508,542 (GRCm39) missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TAGAGCGACTTCCCCAGAGATTCC -3'
(R):5'- TGCCATGTCACAGGACAACCTTC -3'

Sequencing Primer
(F):5'- CAGAGATTCCTAATGCAGAGACTTC -3'
(R):5'- TTTcaaacaaacaaacaaacaaaGC -3'
Posted On 2013-05-23