Incidental Mutation 'R0009:Il22ra2'
ID40482
Institutional Source Beutler Lab
Gene Symbol Il22ra2
Ensembl Gene ENSMUSG00000039760
Gene Nameinterleukin 22 receptor, alpha 2
SynonymsIl-22bp
MMRRC Submission 038304-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0009 (G1)
Quality Score221
Status Validated
Chromosome10
Chromosomal Location19621998-19634681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19624458 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 39 (N39I)
Ref Sequence ENSEMBL: ENSMUSP00000042642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036564]
Predicted Effect probably damaging
Transcript: ENSMUST00000036564
AA Change: N39I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042642
Gene: ENSMUSG00000039760
AA Change: N39I

DomainStartEndE-ValueType
Pfam:Tissue_fac 6 113 3.4e-37 PFAM
Pfam:Interfer-bind 125 230 1.4e-26 PFAM
Meta Mutation Damage Score 0.8924 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the class II cytokine receptor family. The encoded soluble protein specifically binds to and inhibits interleukin 22 activity by blocking the interaction of interleukin 22 with its cell surface receptor. The encoded protein may be important in the regulation of inflammatory response, and has been implicated in the regulation of tumorigenesis in the colon. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation display accelerated tumor formation in a colitis associated colon cancer model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T G 15: 60,919,633 probably benign Het
Abcg4 T G 9: 44,277,649 probably benign Het
Afm C A 5: 90,545,384 probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Aplnr T A 2: 85,137,276 probably null Het
Arih2 T A 9: 108,611,727 H264L probably damaging Het
Atp1a1 A T 3: 101,579,835 I886N possibly damaging Het
Bmf A T 2: 118,549,622 V14E probably damaging Het
Ccdc116 T C 16: 17,144,039 E15G probably damaging Het
Ccdc175 T C 12: 72,135,965 N427D possibly damaging Het
Cfap53 A G 18: 74,299,176 H45R probably benign Het
Chd3 A G 11: 69,349,906 L1569P probably damaging Het
Cntn2 G A 1: 132,516,180 Q457* probably null Het
Coro1a A T 7: 126,701,413 probably benign Het
Cracr2b T A 7: 141,463,759 L91Q probably damaging Het
Ctdspl T C 9: 119,020,046 probably null Het
Dip2b T A 15: 100,169,312 L565Q probably damaging Het
Dip2c T A 13: 9,621,903 C1004S probably damaging Het
Dnah11 A T 12: 118,045,522 I2135N possibly damaging Het
Dnah14 A G 1: 181,769,407 probably benign Het
Dnase1 T C 16: 4,038,946 V147A probably damaging Het
Dusp8 T C 7: 142,082,054 probably benign Het
Fer1l6 T C 15: 58,662,787 Y1828H probably damaging Het
Flvcr1 A G 1: 191,008,191 V544A probably benign Het
Fsd1l T C 4: 53,687,209 V311A probably benign Het
Glud1 G A 14: 34,334,268 G300S probably benign Het
Gm4847 C T 1: 166,630,486 V433I probably benign Het
Gstm3 T G 3: 107,967,840 Y62S probably damaging Het
Gtse1 C T 15: 85,862,435 P151S probably benign Het
Herc2 T C 7: 56,207,812 S4048P probably benign Het
Hp1bp3 T A 4: 138,221,683 I19K probably benign Het
Htr7 C A 19: 36,041,540 probably benign Het
Il1a C T 2: 129,309,074 D10N probably damaging Het
Kcnn4 T C 7: 24,379,255 C267R possibly damaging Het
Larp1 A G 11: 58,055,473 K879R possibly damaging Het
Lcn5 T A 2: 25,661,405 probably benign Het
Lep T A 6: 29,068,972 C7* probably null Het
Magi2 A T 5: 20,611,055 Y747F probably benign Het
Mast4 T C 13: 102,742,058 T1223A probably damaging Het
Mcc C T 18: 44,445,933 E803K probably damaging Het
Mtmr4 T C 11: 87,611,508 I796T probably benign Het
Myef2 A T 2: 125,108,978 D312E probably benign Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Myo19 T A 11: 84,888,169 probably null Het
Naa15 T G 3: 51,470,219 H763Q probably damaging Het
Pde5a C T 3: 122,824,902 probably benign Het
Plpp2 C T 10: 79,527,244 R184H probably benign Het
Rab19 T G 6: 39,389,687 L179V probably damaging Het
Rims2 T A 15: 39,534,966 M1087K probably damaging Het
Riox2 C A 16: 59,489,367 D361E probably benign Het
Sh3rf1 T A 8: 61,226,293 V123E probably damaging Het
Slc35e1 A T 8: 72,484,709 N318K probably damaging Het
Slc9a2 A T 1: 40,763,602 E604V probably benign Het
Srp72 T C 5: 76,987,885 S221P probably damaging Het
Tbx19 A T 1: 165,160,520 S15T possibly damaging Het
Tcea2 A G 2: 181,685,817 T112A probably benign Het
Tesk1 T A 4: 43,445,368 D230E probably damaging Het
Tm4sf5 C T 11: 70,510,712 A179V probably damaging Het
Tnr G T 1: 159,852,416 G320V probably damaging Het
Trappc11 A T 8: 47,503,320 C874S possibly damaging Het
Trpm3 T A 19: 22,914,446 Y885N probably damaging Het
Unc5a T A 13: 55,002,879 C505S probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Xpo5 T C 17: 46,204,786 probably benign Het
Zfp637 C A 6: 117,845,668 H252Q probably damaging Het
Zfp646 T A 7: 127,880,731 D693E probably damaging Het
Other mutations in Il22ra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02572:Il22ra2 APN 10 19626744 missense probably benign 0.04
IGL02835:Il22ra2 UTSW 10 19626676 missense probably benign 0.04
R0009:Il22ra2 UTSW 10 19624458 missense probably damaging 1.00
R1687:Il22ra2 UTSW 10 19632872 missense probably benign 0.09
R1802:Il22ra2 UTSW 10 19626699 missense probably damaging 0.98
R2138:Il22ra2 UTSW 10 19632870 missense probably benign 0.00
R2139:Il22ra2 UTSW 10 19632870 missense probably benign 0.00
R3936:Il22ra2 UTSW 10 19631708 missense probably benign 0.00
R4063:Il22ra2 UTSW 10 19626652 missense possibly damaging 0.88
R4559:Il22ra2 UTSW 10 19626712 missense possibly damaging 0.90
R7578:Il22ra2 UTSW 10 19631624 missense probably benign 0.10
R7661:Il22ra2 UTSW 10 19622078 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGAGCGACTTCCCCAGAGATTCC -3'
(R):5'- TGCCATGTCACAGGACAACCTTC -3'

Sequencing Primer
(F):5'- CAGAGATTCCTAATGCAGAGACTTC -3'
(R):5'- TTTcaaacaaacaaacaaacaaaGC -3'
Posted On2013-05-23