Incidental Mutation 'R5311:Gm14295'
ID 404835
Institutional Source Beutler Lab
Gene Symbol Gm14295
Ensembl Gene ENSMUSG00000078877
Gene Name predicted gene 14295
Synonyms
MMRRC Submission 042894-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock # R5311 (G1)
Quality Score 135
Status Not validated
Chromosome 2
Chromosomal Location 176798612-176811223 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 176810672 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 652 (I652L)
Ref Sequence ENSEMBL: ENSMUSP00000119262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118012] [ENSMUST00000132883] [ENSMUST00000179435]
AlphaFold A2BG91
Predicted Effect probably benign
Transcript: ENSMUST00000118012
SMART Domains Protein: ENSMUSP00000113133
Gene: ENSMUSG00000078877

DomainStartEndE-ValueType
KRAB 4 64 5.2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132883
AA Change: I652L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119262
Gene: ENSMUSG00000078877
AA Change: I652L

DomainStartEndE-ValueType
KRAB 4 66 6.97e-14 SMART
ZnF_C2H2 78 97 1.61e2 SMART
ZnF_C2H2 103 125 4.17e-3 SMART
ZnF_C2H2 131 153 1.67e-2 SMART
ZnF_C2H2 159 181 2.27e-4 SMART
ZnF_C2H2 187 209 2.61e-4 SMART
ZnF_C2H2 215 237 5.5e-3 SMART
ZnF_C2H2 243 265 2.4e-3 SMART
ZnF_C2H2 271 293 6.32e-3 SMART
ZnF_C2H2 299 321 4.17e-3 SMART
ZnF_C2H2 327 349 3.21e-4 SMART
ZnF_C2H2 355 377 6.88e-4 SMART
ZnF_C2H2 383 405 9.22e-5 SMART
ZnF_C2H2 411 433 6.88e-4 SMART
ZnF_C2H2 439 461 9.22e-5 SMART
ZnF_C2H2 467 489 1.67e-2 SMART
ZnF_C2H2 495 517 3.16e-3 SMART
ZnF_C2H2 523 545 1.3e-4 SMART
ZnF_C2H2 551 573 1.67e-2 SMART
ZnF_C2H2 579 601 3.16e-3 SMART
ZnF_C2H2 607 629 6.78e-3 SMART
ZnF_C2H2 635 657 4.54e-4 SMART
ZnF_C2H2 663 685 4.54e-4 SMART
ZnF_C2H2 691 713 1.67e-2 SMART
ZnF_C2H2 719 741 3.16e-3 SMART
ZnF_C2H2 747 769 1.38e-3 SMART
ZnF_C2H2 775 797 4.94e-5 SMART
ZnF_C2H2 803 823 8.75e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179435
SMART Domains Protein: ENSMUSP00000136320
Gene: ENSMUSG00000078877

DomainStartEndE-ValueType
KRAB 3 63 5.2e-13 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5z1 A G 5: 142,467,687 K137E possibly damaging Het
Atm A C 9: 53,518,623 V371G probably benign Het
Cacna2d3 A G 14: 29,347,030 Y247H probably damaging Het
Ccdc180 T C 4: 45,917,556 V927A probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Edar G A 10: 58,607,435 P290S possibly damaging Het
Ext2 T C 2: 93,696,261 I677V probably benign Het
Fam53a A G 5: 33,607,736 S209P probably damaging Het
Fshr A T 17: 89,011,013 probably null Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gm14403 AAACCCTA AA 2: 177,509,655 probably benign Het
Gm5431 T A 11: 48,888,889 E402V probably damaging Het
Gm6899 GGAGGCCGCCCAGTGGCAGAGGCCGCCCAGTGGCAGAGGC GGAGGCCGCCCAGTGGCAGAGGC 11: 26,593,725 probably null Het
Itih2 T C 2: 10,110,535 D342G probably benign Het
Lgi2 A T 5: 52,554,485 D164E probably damaging Het
Lrriq1 A G 10: 103,214,587 I768T probably damaging Het
Map1a C A 2: 121,302,387 A990E probably damaging Het
Mdh1b A G 1: 63,720,004 V143A probably benign Het
Mrgprb3 C T 7: 48,643,311 C164Y probably damaging Het
Mtpap T A 18: 4,386,328 V316E probably damaging Het
Mybpc3 T A 2: 91,128,678 C655* probably null Het
Myh15 A G 16: 49,165,841 E1558G possibly damaging Het
Mylk A G 16: 34,921,757 T880A probably benign Het
Nckap1 T A 2: 80,540,122 D408V probably damaging Het
Nos3 A T 5: 24,377,345 H605L probably benign Het
Nrxn2 C A 19: 6,531,398 D411E probably benign Het
Olfr1057 T A 2: 86,374,750 I221L possibly damaging Het
Olfr366 T C 2: 37,219,621 V44A probably benign Het
Pde4d C A 13: 109,632,864 P29T probably benign Het
Pde4d C T 13: 109,632,865 P29L probably benign Het
Pkhd1 A G 1: 20,565,870 V412A possibly damaging Het
Rev1 T A 1: 38,079,393 I480L probably benign Het
Rimbp3 A G 16: 17,210,844 T711A probably benign Het
RP23-191E1.1 T A 3: 106,297,468 noncoding transcript Het
Serpina11 A T 12: 103,985,962 I183N probably damaging Het
Siglec1 T C 2: 131,079,316 H645R probably damaging Het
Skint7 G A 4: 111,980,304 R93H probably damaging Het
Slfn8 T C 11: 83,004,084 E632G probably damaging Het
Tmem8b G A 4: 43,673,992 V208I probably benign Het
Trps1 G A 15: 50,664,760 T658I probably damaging Het
Ubash3a A G 17: 31,219,717 T287A probably damaging Het
Ugt2b35 G A 5: 87,011,280 W444* probably null Het
Vmn1r219 T A 13: 23,162,893 V84D probably damaging Het
Vmn2r10 T C 5: 109,006,255 Y61C probably damaging Het
Vmn2r104 G A 17: 20,029,901 P703S probably damaging Het
Wdsub1 T A 2: 59,878,529 probably benign Het
Zfp667 A G 7: 6,305,716 Q461R probably benign Het
Zfp941 C A 7: 140,811,959 G496* probably null Het
Other mutations in Gm14295
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1623:Gm14295 UTSW 2 176807364 missense probably damaging 1.00
R2061:Gm14295 UTSW 2 176810681 nonsense probably null
R2172:Gm14295 UTSW 2 176811102 missense possibly damaging 0.48
R2411:Gm14295 UTSW 2 176807413 missense probably benign 0.29
R4472:Gm14295 UTSW 2 176809593 missense possibly damaging 0.71
R4949:Gm14295 UTSW 2 176809676 missense probably damaging 0.99
R5082:Gm14295 UTSW 2 176807417 nonsense probably null
R5792:Gm14295 UTSW 2 176811014 missense probably benign 0.10
R6170:Gm14295 UTSW 2 176811144 unclassified probably benign
R6267:Gm14295 UTSW 2 176808989 nonsense probably null
R6286:Gm14295 UTSW 2 176809568 missense possibly damaging 0.52
R6743:Gm14295 UTSW 2 176810627 missense probably damaging 1.00
R7456:Gm14295 UTSW 2 176809150 missense possibly damaging 0.95
R7536:Gm14295 UTSW 2 176810929 missense possibly damaging 0.74
R8049:Gm14295 UTSW 2 176809078 missense probably benign 0.03
R8126:Gm14295 UTSW 2 176810865 missense probably benign 0.04
R8209:Gm14295 UTSW 2 176811177 missense unknown
R8292:Gm14295 UTSW 2 176809558 missense probably damaging 0.99
R8356:Gm14295 UTSW 2 176809514 missense probably benign 0.24
R8412:Gm14295 UTSW 2 176809629 missense probably damaging 1.00
R8993:Gm14295 UTSW 2 176809830 missense possibly damaging 0.48
R9459:Gm14295 UTSW 2 176807372 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AAAAGCCTTTGCAAGAAGTGGTGA -3'
(R):5'- GCAAAGGCTTTACCACATTGG -3'

Sequencing Primer
(F):5'- GTGGTAAAGCCTTTGCACATAGC -3'
(R):5'- CCACATTGGTTACATTCATAGGG -3'
Posted On 2016-07-22