Incidental Mutation 'R0009:Larp1'
ID40484
Institutional Source Beutler Lab
Gene Symbol Larp1
Ensembl Gene ENSMUSG00000037331
Gene NameLa ribonucleoprotein domain family, member 1
Synonyms1810024J12Rik, 3110040D16Rik, Larp
MMRRC Submission 038304-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0009 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58009064-58062034 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58055473 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 879 (K879R)
Ref Sequence ENSEMBL: ENSMUSP00000071421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071487] [ENSMUST00000178636]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071487
AA Change: K879R

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000071421
Gene: ENSMUSG00000037331
AA Change: K879R

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 37 87 N/A INTRINSIC
low complexity region 106 120 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 304 331 N/A INTRINSIC
LA 376 452 1.98e-40 SMART
low complexity region 538 555 N/A INTRINSIC
low complexity region 562 571 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
low complexity region 758 766 N/A INTRINSIC
DM15 861 902 7.3e-20 SMART
DM15 903 941 3.85e-19 SMART
DM15 942 977 8.59e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000178636
AA Change: K879R

PolyPhen 2 Score 0.776 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136673
Gene: ENSMUSG00000037331
AA Change: K879R

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 37 87 N/A INTRINSIC
low complexity region 106 120 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 304 331 N/A INTRINSIC
LA 376 452 1.98e-40 SMART
low complexity region 538 555 N/A INTRINSIC
low complexity region 562 571 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
low complexity region 758 766 N/A INTRINSIC
DM15 861 902 7.3e-20 SMART
DM15 903 941 3.85e-19 SMART
DM15 942 977 8.59e-1 SMART
Meta Mutation Damage Score 0.2859 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T G 15: 60,919,633 probably benign Het
Abcg4 T G 9: 44,277,649 probably benign Het
Afm C A 5: 90,545,384 probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Aplnr T A 2: 85,137,276 probably null Het
Arih2 T A 9: 108,611,727 H264L probably damaging Het
Atp1a1 A T 3: 101,579,835 I886N possibly damaging Het
Bmf A T 2: 118,549,622 V14E probably damaging Het
Ccdc116 T C 16: 17,144,039 E15G probably damaging Het
Ccdc175 T C 12: 72,135,965 N427D possibly damaging Het
Cfap53 A G 18: 74,299,176 H45R probably benign Het
Chd3 A G 11: 69,349,906 L1569P probably damaging Het
Cntn2 G A 1: 132,516,180 Q457* probably null Het
Coro1a A T 7: 126,701,413 probably benign Het
Cracr2b T A 7: 141,463,759 L91Q probably damaging Het
Ctdspl T C 9: 119,020,046 probably null Het
Dip2b T A 15: 100,169,312 L565Q probably damaging Het
Dip2c T A 13: 9,621,903 C1004S probably damaging Het
Dnah11 A T 12: 118,045,522 I2135N possibly damaging Het
Dnah14 A G 1: 181,769,407 probably benign Het
Dnase1 T C 16: 4,038,946 V147A probably damaging Het
Dusp8 T C 7: 142,082,054 probably benign Het
Fer1l6 T C 15: 58,662,787 Y1828H probably damaging Het
Flvcr1 A G 1: 191,008,191 V544A probably benign Het
Fsd1l T C 4: 53,687,209 V311A probably benign Het
Glud1 G A 14: 34,334,268 G300S probably benign Het
Gm4847 C T 1: 166,630,486 V433I probably benign Het
Gstm3 T G 3: 107,967,840 Y62S probably damaging Het
Gtse1 C T 15: 85,862,435 P151S probably benign Het
Herc2 T C 7: 56,207,812 S4048P probably benign Het
Hp1bp3 T A 4: 138,221,683 I19K probably benign Het
Htr7 C A 19: 36,041,540 probably benign Het
Il1a C T 2: 129,309,074 D10N probably damaging Het
Il22ra2 A T 10: 19,624,458 N39I probably damaging Het
Kcnn4 T C 7: 24,379,255 C267R possibly damaging Het
Lcn5 T A 2: 25,661,405 probably benign Het
Lep T A 6: 29,068,972 C7* probably null Het
Magi2 A T 5: 20,611,055 Y747F probably benign Het
Mast4 T C 13: 102,742,058 T1223A probably damaging Het
Mcc C T 18: 44,445,933 E803K probably damaging Het
Mtmr4 T C 11: 87,611,508 I796T probably benign Het
Myef2 A T 2: 125,108,978 D312E probably benign Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Myo19 T A 11: 84,888,169 probably null Het
Naa15 T G 3: 51,470,219 H763Q probably damaging Het
Pde5a C T 3: 122,824,902 probably benign Het
Plpp2 C T 10: 79,527,244 R184H probably benign Het
Rab19 T G 6: 39,389,687 L179V probably damaging Het
Rims2 T A 15: 39,534,966 M1087K probably damaging Het
Riox2 C A 16: 59,489,367 D361E probably benign Het
Sh3rf1 T A 8: 61,226,293 V123E probably damaging Het
Slc35e1 A T 8: 72,484,709 N318K probably damaging Het
Slc9a2 A T 1: 40,763,602 E604V probably benign Het
Srp72 T C 5: 76,987,885 S221P probably damaging Het
Tbx19 A T 1: 165,160,520 S15T possibly damaging Het
Tcea2 A G 2: 181,685,817 T112A probably benign Het
Tesk1 T A 4: 43,445,368 D230E probably damaging Het
Tm4sf5 C T 11: 70,510,712 A179V probably damaging Het
Tnr G T 1: 159,852,416 G320V probably damaging Het
Trappc11 A T 8: 47,503,320 C874S possibly damaging Het
Trpm3 T A 19: 22,914,446 Y885N probably damaging Het
Unc5a T A 13: 55,002,879 C505S probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Xpo5 T C 17: 46,204,786 probably benign Het
Zfp637 C A 6: 117,845,668 H252Q probably damaging Het
Zfp646 T A 7: 127,880,731 D693E probably damaging Het
Other mutations in Larp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01537:Larp1 APN 11 58042822 missense possibly damaging 0.91
IGL02114:Larp1 APN 11 58057055 missense probably damaging 1.00
IGL03084:Larp1 APN 11 58057095 missense probably damaging 1.00
IGL03126:Larp1 APN 11 58050877 missense possibly damaging 0.65
IGL03278:Larp1 APN 11 58044056 splice site probably benign
Bayou UTSW 11 58058596 frame shift probably null
R0020:Larp1 UTSW 11 58050023 missense probably damaging 1.00
R0479:Larp1 UTSW 11 58042820 missense possibly damaging 0.92
R0845:Larp1 UTSW 11 58047750 missense probably benign 0.00
R1691:Larp1 UTSW 11 58048048 missense probably benign 0.08
R1793:Larp1 UTSW 11 58049938 missense possibly damaging 0.60
R3618:Larp1 UTSW 11 58057346 missense probably benign 0.03
R4689:Larp1 UTSW 11 58041613 missense probably damaging 1.00
R4797:Larp1 UTSW 11 58047980 nonsense probably null
R5089:Larp1 UTSW 11 58047867 missense possibly damaging 0.92
R5309:Larp1 UTSW 11 58050808 missense possibly damaging 0.72
R5883:Larp1 UTSW 11 58042299 missense probably damaging 0.97
R5951:Larp1 UTSW 11 58049939 missense probably benign 0.14
R6038:Larp1 UTSW 11 58041605 missense possibly damaging 0.68
R6038:Larp1 UTSW 11 58041605 missense possibly damaging 0.68
R6266:Larp1 UTSW 11 58042263 missense probably damaging 0.99
R6350:Larp1 UTSW 11 58049831 missense probably benign 0.14
R6650:Larp1 UTSW 11 58058596 frame shift probably null
R6687:Larp1 UTSW 11 58057330 missense probably damaging 0.99
R6736:Larp1 UTSW 11 58042647 splice site probably null
R6881:Larp1 UTSW 11 58050023 missense probably damaging 1.00
R7368:Larp1 UTSW 11 58048078 missense probably damaging 1.00
R7547:Larp1 UTSW 11 58052579 critical splice acceptor site probably null
R7838:Larp1 UTSW 11 58047714 missense possibly damaging 0.82
R7921:Larp1 UTSW 11 58047714 missense possibly damaging 0.82
Z1177:Larp1 UTSW 11 58049787 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTTCAGCAGTATTCTGCCAGTTCC -3'
(R):5'- AACTAGAGCCCCTGGCTCACTC -3'

Sequencing Primer
(F):5'- agcagcaacaacaaaaaatgatg -3'
(R):5'- GGCTCACTCACCTGTAGC -3'
Posted On2013-05-23