Incidental Mutation 'R5311:Pde4d'
ID404864
Institutional Source Beutler Lab
Gene Symbol Pde4d
Ensembl Gene ENSMUSG00000021699
Gene Namephosphodiesterase 4D, cAMP specific
Synonymsdunce, Dpde3, 9630011N22Rik
MMRRC Submission 042894-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5311 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location108449948-109953461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 109632865 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 29 (P29L)
Ref Sequence ENSEMBL: ENSMUSP00000119583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079975] [ENSMUST00000119507] [ENSMUST00000120671] [ENSMUST00000122041] [ENSMUST00000135275] [ENSMUST00000177907]
Predicted Effect probably benign
Transcript: ENSMUST00000079975
SMART Domains Protein: ENSMUSP00000078891
Gene: ENSMUSG00000021699

DomainStartEndE-ValueType
HDc 349 524 1.12e-2 SMART
low complexity region 672 687 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119507
SMART Domains Protein: ENSMUSP00000114089
Gene: ENSMUSG00000021699

DomainStartEndE-ValueType
HDc 354 529 1.12e-2 SMART
low complexity region 677 692 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120671
SMART Domains Protein: ENSMUSP00000112991
Gene: ENSMUSG00000021699

DomainStartEndE-ValueType
low complexity region 45 84 N/A INTRINSIC
HDc 454 629 1.12e-2 SMART
low complexity region 777 792 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122041
SMART Domains Protein: ENSMUSP00000113488
Gene: ENSMUSG00000021699

DomainStartEndE-ValueType
HDc 398 573 1.12e-2 SMART
low complexity region 721 736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135275
AA Change: P29L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119583
Gene: ENSMUSG00000021699
AA Change: P29L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
HDc 351 526 1.12e-2 SMART
low complexity region 674 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138938
Predicted Effect probably benign
Transcript: ENSMUST00000153234
SMART Domains Protein: ENSMUSP00000121592
Gene: ENSMUSG00000021699

DomainStartEndE-ValueType
PDB:1E9K|A 22 59 9e-18 PDB
low complexity region 69 85 N/A INTRINSIC
HDc 405 580 1.12e-2 SMART
low complexity region 728 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177907
SMART Domains Protein: ENSMUSP00000136485
Gene: ENSMUSG00000021699

DomainStartEndE-ValueType
HDc 398 573 1.12e-2 SMART
low complexity region 721 736 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit delayed growth, female infertility associated with impaired ovulation, and reduced postnatal viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5z1 A G 5: 142,467,687 K137E possibly damaging Het
Atm A C 9: 53,518,623 V371G probably benign Het
Cacna2d3 A G 14: 29,347,030 Y247H probably damaging Het
Ccdc180 T C 4: 45,917,556 V927A probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Edar G A 10: 58,607,435 P290S possibly damaging Het
Ext2 T C 2: 93,696,261 I677V probably benign Het
Fam53a A G 5: 33,607,736 S209P probably damaging Het
Fshr A T 17: 89,011,013 probably null Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gm14295 A T 2: 176,810,672 I652L probably benign Het
Gm14403 AAACCCTA AA 2: 177,509,655 probably benign Het
Gm5431 T A 11: 48,888,889 E402V probably damaging Het
Gm6899 GGAGGCCGCCCAGTGGCAGAGGCCGCCCAGTGGCAGAGGC GGAGGCCGCCCAGTGGCAGAGGC 11: 26,593,725 probably null Het
Itih2 T C 2: 10,110,535 D342G probably benign Het
Lgi2 A T 5: 52,554,485 D164E probably damaging Het
Lrriq1 A G 10: 103,214,587 I768T probably damaging Het
Map1a C A 2: 121,302,387 A990E probably damaging Het
Mdh1b A G 1: 63,720,004 V143A probably benign Het
Mrgprb3 C T 7: 48,643,311 C164Y probably damaging Het
Mtpap T A 18: 4,386,328 V316E probably damaging Het
Mybpc3 T A 2: 91,128,678 C655* probably null Het
Myh15 A G 16: 49,165,841 E1558G possibly damaging Het
Mylk A G 16: 34,921,757 T880A probably benign Het
Nckap1 T A 2: 80,540,122 D408V probably damaging Het
Nos3 A T 5: 24,377,345 H605L probably benign Het
Nrxn2 C A 19: 6,531,398 D411E probably benign Het
Olfr1057 T A 2: 86,374,750 I221L possibly damaging Het
Olfr366 T C 2: 37,219,621 V44A probably benign Het
Pkhd1 A G 1: 20,565,870 V412A possibly damaging Het
Rev1 T A 1: 38,079,393 I480L probably benign Het
Rimbp3 A G 16: 17,210,844 T711A probably benign Het
RP23-191E1.1 T A 3: 106,297,468 noncoding transcript Het
Serpina11 A T 12: 103,985,962 I183N probably damaging Het
Siglec1 T C 2: 131,079,316 H645R probably damaging Het
Skint7 G A 4: 111,980,304 R93H probably damaging Het
Slfn8 T C 11: 83,004,084 E632G probably damaging Het
Tmem8b G A 4: 43,673,992 V208I probably benign Het
Trps1 G A 15: 50,664,760 T658I probably damaging Het
Ubash3a A G 17: 31,219,717 T287A probably damaging Het
Ugt2b35 G A 5: 87,011,280 W444* probably null Het
Vmn1r219 T A 13: 23,162,893 V84D probably damaging Het
Vmn2r10 T C 5: 109,006,255 Y61C probably damaging Het
Vmn2r104 G A 17: 20,029,901 P703S probably damaging Het
Wdsub1 T A 2: 59,878,529 probably benign Het
Zfp667 A G 7: 6,305,716 Q461R probably benign Het
Zfp941 C A 7: 140,811,959 G496* probably null Het
Other mutations in Pde4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Pde4d APN 13 109936687 missense possibly damaging 0.69
IGL00792:Pde4d APN 13 109935395 missense possibly damaging 0.85
IGL01014:Pde4d APN 13 109949502 missense probably damaging 1.00
IGL01660:Pde4d APN 13 109938072 missense probably damaging 1.00
IGL02233:Pde4d APN 13 109740550 missense probably damaging 1.00
IGL02405:Pde4d APN 13 108860209 critical splice donor site probably null
IGL02544:Pde4d APN 13 109740523 missense probably damaging 1.00
IGL02885:Pde4d APN 13 109948261 missense probably damaging 1.00
IGL03286:Pde4d APN 13 109954506 unclassified probably benign
IGL03406:Pde4d APN 13 109954591 unclassified probably benign
Heliosphere UTSW 13 109116942 missense probably benign
Stubbs UTSW 13 109772722 intron probably benign
IGL03055:Pde4d UTSW 13 109935345 missense probably damaging 1.00
R0020:Pde4d UTSW 13 109954570 missense possibly damaging 0.66
R0020:Pde4d UTSW 13 109954570 missense possibly damaging 0.66
R0054:Pde4d UTSW 13 109740421 missense probably benign 0.23
R0054:Pde4d UTSW 13 109740421 missense probably benign 0.23
R0357:Pde4d UTSW 13 109951268 missense possibly damaging 0.46
R0482:Pde4d UTSW 13 109936710 missense probably benign 0.00
R0689:Pde4d UTSW 13 109740544 missense possibly damaging 0.78
R0884:Pde4d UTSW 13 109950940 missense probably damaging 0.99
R1169:Pde4d UTSW 13 109950928 splice site probably null
R1225:Pde4d UTSW 13 109950221 missense probably benign 0.04
R1246:Pde4d UTSW 13 109950973 missense probably damaging 1.00
R1344:Pde4d UTSW 13 109950387 nonsense probably null
R1351:Pde4d UTSW 13 109951275 missense possibly damaging 0.46
R1371:Pde4d UTSW 13 109117061 missense probably benign 0.00
R1418:Pde4d UTSW 13 109950387 nonsense probably null
R2197:Pde4d UTSW 13 109948390 missense probably damaging 1.00
R2440:Pde4d UTSW 13 109927197 intron probably benign
R3114:Pde4d UTSW 13 109948258 missense probably damaging 1.00
R3115:Pde4d UTSW 13 109948258 missense probably damaging 1.00
R3722:Pde4d UTSW 13 109951332 nonsense probably null
R3742:Pde4d UTSW 13 109740479 missense probably benign 0.42
R3797:Pde4d UTSW 13 109632897 missense probably benign 0.29
R3983:Pde4d UTSW 13 109740406 missense probably benign 0.23
R4618:Pde4d UTSW 13 109933877 missense probably benign 0.13
R4768:Pde4d UTSW 13 109933874 missense probably damaging 1.00
R4795:Pde4d UTSW 13 109938171 intron probably benign
R4824:Pde4d UTSW 13 109116866 missense probably benign 0.00
R4942:Pde4d UTSW 13 108860199 missense probably benign 0.00
R4984:Pde4d UTSW 13 109740464 missense probably damaging 1.00
R5180:Pde4d UTSW 13 109740473 missense probably benign 0.13
R5267:Pde4d UTSW 13 109260809 intron probably benign
R5311:Pde4d UTSW 13 109632864 missense probably benign 0.02
R5376:Pde4d UTSW 13 109772644 missense probably benign 0.00
R5551:Pde4d UTSW 13 109948396 critical splice donor site probably null
R5753:Pde4d UTSW 13 109772722 intron probably benign
R5754:Pde4d UTSW 13 109938013 missense probably damaging 0.98
R5838:Pde4d UTSW 13 109740442 missense probably damaging 0.99
R5864:Pde4d UTSW 13 109938048 missense probably benign 0.00
R6039:Pde4d UTSW 13 109948342 missense probably damaging 1.00
R6039:Pde4d UTSW 13 109948342 missense probably damaging 1.00
R6049:Pde4d UTSW 13 109032585 nonsense probably null
R6214:Pde4d UTSW 13 109949433 missense probably damaging 1.00
R6215:Pde4d UTSW 13 109949433 missense probably damaging 1.00
R6273:Pde4d UTSW 13 109950221 missense possibly damaging 0.94
R6431:Pde4d UTSW 13 109601786 unclassified probably null
R6501:Pde4d UTSW 13 109116942 missense probably benign
R6534:Pde4d UTSW 13 109632901 missense probably benign 0.05
R6709:Pde4d UTSW 13 109948279 missense probably damaging 1.00
R6722:Pde4d UTSW 13 109632898 nonsense probably null
R7164:Pde4d UTSW 13 109032688 missense probably benign
R7222:Pde4d UTSW 13 109757579 missense probably damaging 1.00
R7417:Pde4d UTSW 13 109632788 synonymous probably null
R7489:Pde4d UTSW 13 109116767 missense unknown
R7563:Pde4d UTSW 13 109951007 missense probably benign 0.37
R7861:Pde4d UTSW 13 109935324 missense probably damaging 0.99
R7944:Pde4d UTSW 13 109935324 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCGCAAAGGGCAAGTGTCAC -3'
(R):5'- TACAATAGCCCAGGAGCTGAG -3'

Sequencing Primer
(F):5'- GAAGTGCTGGCCACCCTTTC -3'
(R):5'- GAGCTGAGCCGGACATTAACC -3'
Posted On2016-07-22