Incidental Mutation 'R5311:Rimbp3'
ID 404866
Institutional Source Beutler Lab
Gene Symbol Rimbp3
Ensembl Gene ENSMUSG00000071636
Gene Name RIMS binding protein 3
Synonyms RIM-BP3, LOC239731, LOC385766
MMRRC Submission 042894-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock # R5311 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 17208603-17213982 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 17210844 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 711 (T711A)
Ref Sequence ENSEMBL: ENSMUSP00000127909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169803]
AlphaFold Q3V0F0
Predicted Effect probably benign
Transcript: ENSMUST00000169803
AA Change: T711A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127909
Gene: ENSMUSG00000071636
AA Change: T711A

DomainStartEndE-ValueType
coiled coil region 25 56 N/A INTRINSIC
coiled coil region 84 145 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
coiled coil region 395 431 N/A INTRINSIC
coiled coil region 547 610 N/A INTRINSIC
low complexity region 688 701 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
SH3 825 888 7.58e-8 SMART
low complexity region 913 924 N/A INTRINSIC
FN3 980 1052 2.21e-3 SMART
FN3 1073 1160 1.91e1 SMART
low complexity region 1236 1243 N/A INTRINSIC
SH3 1423 1487 5.08e-2 SMART
SH3 1539 1602 5.97e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179034
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for a null mutation display infertility with impaired spermiogenesis and defects in sperm head and flagellum morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5z1 A G 5: 142,467,687 K137E possibly damaging Het
Atm A C 9: 53,518,623 V371G probably benign Het
Cacna2d3 A G 14: 29,347,030 Y247H probably damaging Het
Ccdc180 T C 4: 45,917,556 V927A probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Edar G A 10: 58,607,435 P290S possibly damaging Het
Ext2 T C 2: 93,696,261 I677V probably benign Het
Fam53a A G 5: 33,607,736 S209P probably damaging Het
Fshr A T 17: 89,011,013 probably null Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gm14295 A T 2: 176,810,672 I652L probably benign Het
Gm14403 AAACCCTA AA 2: 177,509,655 probably benign Het
Gm5431 T A 11: 48,888,889 E402V probably damaging Het
Gm6899 GGAGGCCGCCCAGTGGCAGAGGCCGCCCAGTGGCAGAGGC GGAGGCCGCCCAGTGGCAGAGGC 11: 26,593,725 probably null Het
Itih2 T C 2: 10,110,535 D342G probably benign Het
Lgi2 A T 5: 52,554,485 D164E probably damaging Het
Lrriq1 A G 10: 103,214,587 I768T probably damaging Het
Map1a C A 2: 121,302,387 A990E probably damaging Het
Mdh1b A G 1: 63,720,004 V143A probably benign Het
Mrgprb3 C T 7: 48,643,311 C164Y probably damaging Het
Mtpap T A 18: 4,386,328 V316E probably damaging Het
Mybpc3 T A 2: 91,128,678 C655* probably null Het
Myh15 A G 16: 49,165,841 E1558G possibly damaging Het
Mylk A G 16: 34,921,757 T880A probably benign Het
Nckap1 T A 2: 80,540,122 D408V probably damaging Het
Nos3 A T 5: 24,377,345 H605L probably benign Het
Nrxn2 C A 19: 6,531,398 D411E probably benign Het
Olfr1057 T A 2: 86,374,750 I221L possibly damaging Het
Olfr366 T C 2: 37,219,621 V44A probably benign Het
Pde4d C A 13: 109,632,864 P29T probably benign Het
Pde4d C T 13: 109,632,865 P29L probably benign Het
Pkhd1 A G 1: 20,565,870 V412A possibly damaging Het
Rev1 T A 1: 38,079,393 I480L probably benign Het
RP23-191E1.1 T A 3: 106,297,468 noncoding transcript Het
Serpina11 A T 12: 103,985,962 I183N probably damaging Het
Siglec1 T C 2: 131,079,316 H645R probably damaging Het
Skint7 G A 4: 111,980,304 R93H probably damaging Het
Slfn8 T C 11: 83,004,084 E632G probably damaging Het
Tmem8b G A 4: 43,673,992 V208I probably benign Het
Trps1 G A 15: 50,664,760 T658I probably damaging Het
Ubash3a A G 17: 31,219,717 T287A probably damaging Het
Ugt2b35 G A 5: 87,011,280 W444* probably null Het
Vmn1r219 T A 13: 23,162,893 V84D probably damaging Het
Vmn2r10 T C 5: 109,006,255 Y61C probably damaging Het
Vmn2r104 G A 17: 20,029,901 P703S probably damaging Het
Wdsub1 T A 2: 59,878,529 probably benign Het
Zfp667 A G 7: 6,305,716 Q461R probably benign Het
Zfp941 C A 7: 140,811,959 G496* probably null Het
Other mutations in Rimbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rimbp3 APN 16 17209743 missense probably benign 0.01
IGL00786:Rimbp3 APN 16 17211688 missense probably damaging 0.99
IGL01411:Rimbp3 APN 16 17211094 missense probably damaging 1.00
IGL01434:Rimbp3 APN 16 17211702 missense probably benign 0.13
IGL01895:Rimbp3 APN 16 17211436 missense probably damaging 0.99
IGL02322:Rimbp3 APN 16 17211615 missense probably benign 0.00
IGL02649:Rimbp3 APN 16 17209608 nonsense probably null
IGL03285:Rimbp3 APN 16 17213232 missense probably benign 0.16
PIT4581001:Rimbp3 UTSW 16 17210716 missense possibly damaging 0.76
R0279:Rimbp3 UTSW 16 17209453 missense probably benign 0.00
R0465:Rimbp3 UTSW 16 17211780 missense possibly damaging 0.86
R0605:Rimbp3 UTSW 16 17211699 missense probably damaging 0.99
R0674:Rimbp3 UTSW 16 17212737 missense probably benign 0.02
R1676:Rimbp3 UTSW 16 17211113 missense probably benign 0.13
R1780:Rimbp3 UTSW 16 17212632 missense probably benign
R1946:Rimbp3 UTSW 16 17210427 missense probably benign 0.10
R2113:Rimbp3 UTSW 16 17209675 missense probably benign 0.00
R3847:Rimbp3 UTSW 16 17210299 missense probably benign 0.13
R3849:Rimbp3 UTSW 16 17210299 missense probably benign 0.13
R3850:Rimbp3 UTSW 16 17210299 missense probably benign 0.13
R4355:Rimbp3 UTSW 16 17209692 missense possibly damaging 0.56
R4646:Rimbp3 UTSW 16 17213098 missense probably damaging 0.99
R4669:Rimbp3 UTSW 16 17209189 missense possibly damaging 0.88
R4732:Rimbp3 UTSW 16 17210601 missense possibly damaging 0.94
R4733:Rimbp3 UTSW 16 17210601 missense possibly damaging 0.94
R5025:Rimbp3 UTSW 16 17209807 missense probably damaging 0.99
R5039:Rimbp3 UTSW 16 17213331 missense probably damaging 0.99
R5177:Rimbp3 UTSW 16 17209917 missense possibly damaging 0.85
R5942:Rimbp3 UTSW 16 17211888 missense probably benign 0.00
R6063:Rimbp3 UTSW 16 17210917 missense probably damaging 1.00
R6092:Rimbp3 UTSW 16 17212270 missense probably damaging 1.00
R6126:Rimbp3 UTSW 16 17212276 missense probably benign 0.25
R6288:Rimbp3 UTSW 16 17212908 missense probably benign 0.22
R6446:Rimbp3 UTSW 16 17212929 missense probably benign 0.00
R6773:Rimbp3 UTSW 16 17209015 missense probably damaging 1.00
R7017:Rimbp3 UTSW 16 17209746 missense probably benign 0.04
R7043:Rimbp3 UTSW 16 17211108 missense probably damaging 1.00
R7048:Rimbp3 UTSW 16 17210326 missense probably benign 0.20
R7378:Rimbp3 UTSW 16 17211204 missense probably benign
R7440:Rimbp3 UTSW 16 17213201 missense possibly damaging 0.78
R7788:Rimbp3 UTSW 16 17212704 missense probably benign 0.00
R7879:Rimbp3 UTSW 16 17211046 missense possibly damaging 0.71
R8071:Rimbp3 UTSW 16 17210863 missense probably benign
R8272:Rimbp3 UTSW 16 17209105 missense possibly damaging 0.85
R8419:Rimbp3 UTSW 16 17213022 missense probably damaging 0.97
R8819:Rimbp3 UTSW 16 17210907 missense probably benign 0.17
R8830:Rimbp3 UTSW 16 17209006 missense probably damaging 0.98
R8936:Rimbp3 UTSW 16 17213020 missense probably benign
R8982:Rimbp3 UTSW 16 17209647 missense probably benign 0.11
R9365:Rimbp3 UTSW 16 17208756 missense possibly damaging 0.93
Z1176:Rimbp3 UTSW 16 17209474 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AACTCGAAGCCACTAGCCTG -3'
(R):5'- CCACATGGACTCTACCTCTGAG -3'

Sequencing Primer
(F):5'- CTGCTGCAACAAGAGGGATATGC -3'
(R):5'- CTCTGAGGAGGAATTTGACTGTGAAC -3'
Posted On 2016-07-22