Incidental Mutation 'R5311:Cdc45'
ID404867
Institutional Source Beutler Lab
Gene Symbol Cdc45
Ensembl Gene ENSMUSG00000000028
Gene Namecell division cycle 45
SynonymsCdc45l
MMRRC Submission 042894-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5311 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location18780447-18811987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 18795897 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 205 (R205H)
Ref Sequence ENSEMBL: ENSMUSP00000094753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000028] [ENSMUST00000096990]
Predicted Effect probably damaging
Transcript: ENSMUST00000000028
AA Change: R251H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000028
Gene: ENSMUSG00000000028
AA Change: R251H

DomainStartEndE-ValueType
Pfam:CDC45 19 564 1.6e-152 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000096990
AA Change: R205H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094753
Gene: ENSMUSG00000000028
AA Change: R205H

DomainStartEndE-ValueType
Pfam:CDC45 18 74 7.9e-24 PFAM
Pfam:CDC45 73 520 4.5e-138 PFAM
Meta Mutation Damage Score 0.1932 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified by its strong similarity with Saccharomyces cerevisiae Cdc45, an essential protein required to the initiation of DNA replication. Cdc45 is a member of the highly conserved multiprotein complex including Cdc6/Cdc18, the minichromosome maintenance proteins (MCMs) and DNA polymerase, which is important for early steps of DNA replication in eukaryotes. This protein has been shown to interact with MCM7 and DNA polymerase alpha. Studies of the similar gene in Xenopus suggested that this protein play a pivotal role in the loading of DNA polymerase alpha onto chromatin. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutant embryos do not develop after implantation, resulting in embryonic lethality between E4.5-E5.5. Heterozygous animals appear normal and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5z1 A G 5: 142,467,687 K137E possibly damaging Het
Atm A C 9: 53,518,623 V371G probably benign Het
Cacna2d3 A G 14: 29,347,030 Y247H probably damaging Het
Ccdc180 T C 4: 45,917,556 V927A probably damaging Het
Edar G A 10: 58,607,435 P290S possibly damaging Het
Ext2 T C 2: 93,696,261 I677V probably benign Het
Fam53a A G 5: 33,607,736 S209P probably damaging Het
Fshr A T 17: 89,011,013 probably null Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gm14295 A T 2: 176,810,672 I652L probably benign Het
Gm14403 AAACCCTA AA 2: 177,509,655 probably benign Het
Gm5431 T A 11: 48,888,889 E402V probably damaging Het
Gm6899 GGAGGCCGCCCAGTGGCAGAGGCCGCCCAGTGGCAGAGGC GGAGGCCGCCCAGTGGCAGAGGC 11: 26,593,725 probably null Het
Itih2 T C 2: 10,110,535 D342G probably benign Het
Lgi2 A T 5: 52,554,485 D164E probably damaging Het
Lrriq1 A G 10: 103,214,587 I768T probably damaging Het
Map1a C A 2: 121,302,387 A990E probably damaging Het
Mdh1b A G 1: 63,720,004 V143A probably benign Het
Mrgprb3 C T 7: 48,643,311 C164Y probably damaging Het
Mtpap T A 18: 4,386,328 V316E probably damaging Het
Mybpc3 T A 2: 91,128,678 C655* probably null Het
Myh15 A G 16: 49,165,841 E1558G possibly damaging Het
Mylk A G 16: 34,921,757 T880A probably benign Het
Nckap1 T A 2: 80,540,122 D408V probably damaging Het
Nos3 A T 5: 24,377,345 H605L probably benign Het
Nrxn2 C A 19: 6,531,398 D411E probably benign Het
Olfr1057 T A 2: 86,374,750 I221L possibly damaging Het
Olfr366 T C 2: 37,219,621 V44A probably benign Het
Pde4d C A 13: 109,632,864 P29T probably benign Het
Pde4d C T 13: 109,632,865 P29L probably benign Het
Pkhd1 A G 1: 20,565,870 V412A possibly damaging Het
Rev1 T A 1: 38,079,393 I480L probably benign Het
Rimbp3 A G 16: 17,210,844 T711A probably benign Het
RP23-191E1.1 T A 3: 106,297,468 noncoding transcript Het
Serpina11 A T 12: 103,985,962 I183N probably damaging Het
Siglec1 T C 2: 131,079,316 H645R probably damaging Het
Skint7 G A 4: 111,980,304 R93H probably damaging Het
Slfn8 T C 11: 83,004,084 E632G probably damaging Het
Tmem8b G A 4: 43,673,992 V208I probably benign Het
Trps1 G A 15: 50,664,760 T658I probably damaging Het
Ubash3a A G 17: 31,219,717 T287A probably damaging Het
Ugt2b35 G A 5: 87,011,280 W444* probably null Het
Vmn1r219 T A 13: 23,162,893 V84D probably damaging Het
Vmn2r10 T C 5: 109,006,255 Y61C probably damaging Het
Vmn2r104 G A 17: 20,029,901 P703S probably damaging Het
Wdsub1 T A 2: 59,878,529 probably benign Het
Zfp667 A G 7: 6,305,716 Q461R probably benign Het
Zfp941 C A 7: 140,811,959 G496* probably null Het
Other mutations in Cdc45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:Cdc45 APN 16 18811561 missense probably damaging 1.00
IGL01677:Cdc45 APN 16 18787000 missense probably benign 0.02
IGL02079:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02080:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02105:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02106:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02237:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02238:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02239:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02371:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02441:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02442:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02465:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02466:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02468:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02469:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02470:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02471:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02472:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02473:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02489:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02490:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02491:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02492:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02511:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02558:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02559:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02560:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02561:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02562:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02566:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02567:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02576:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02583:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02589:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02626:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02627:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02628:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02629:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02687:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02688:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02689:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02720:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02724:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02731:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02738:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02991:Cdc45 UTSW 16 18798729 missense probably benign 0.06
R0051:Cdc45 UTSW 16 18794774 missense probably damaging 1.00
R0051:Cdc45 UTSW 16 18794774 missense probably damaging 1.00
R0458:Cdc45 UTSW 16 18781972 splice site probably benign
R1398:Cdc45 UTSW 16 18781971 splice site probably benign
R1413:Cdc45 UTSW 16 18808741 missense possibly damaging 0.63
R1792:Cdc45 UTSW 16 18807340 missense probably benign 0.01
R2919:Cdc45 UTSW 16 18808793 missense probably benign 0.00
R3956:Cdc45 UTSW 16 18805430 missense probably benign 0.00
R4079:Cdc45 UTSW 16 18811360 missense probably damaging 1.00
R4825:Cdc45 UTSW 16 18784863 missense probably damaging 0.98
R5028:Cdc45 UTSW 16 18795180 missense probably benign 0.43
R5214:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5215:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5309:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5312:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5352:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5353:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5354:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5355:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5356:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5424:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5426:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5655:Cdc45 UTSW 16 18807279 critical splice donor site probably null
R6174:Cdc45 UTSW 16 18794704 intron probably null
R6796:Cdc45 UTSW 16 18784857 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGGCATGACTCAGACATC -3'
(R):5'- ACCTAAAGATGGGGCATAGC -3'

Sequencing Primer
(F):5'- AGGACATGGGTGGTTCTATCAC -3'
(R):5'- ATAGCCTGGCCAGAGAGCAC -3'
Posted On2016-07-22