Incidental Mutation 'R0009:Myo19'
ID 40487
Institutional Source Beutler Lab
Gene Symbol Myo19
Ensembl Gene ENSMUSG00000020527
Gene Name myosin XIX
Synonyms Myohd1, 1110055A02Rik
MMRRC Submission 038304-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.159) question?
Stock # R0009 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 84880148-84911226 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 84888169 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020837] [ENSMUST00000020837] [ENSMUST00000020837] [ENSMUST00000020837] [ENSMUST00000093969] [ENSMUST00000093969] [ENSMUST00000093969] [ENSMUST00000093969]
AlphaFold Q5SV80
Predicted Effect probably null
Transcript: ENSMUST00000020837
SMART Domains Protein: ENSMUSP00000020837
Gene: ENSMUSG00000020527

DomainStartEndE-ValueType
MYSc 29 205 2.18e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000020837
SMART Domains Protein: ENSMUSP00000020837
Gene: ENSMUSG00000020527

DomainStartEndE-ValueType
MYSc 29 205 2.18e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000020837
SMART Domains Protein: ENSMUSP00000020837
Gene: ENSMUSG00000020527

DomainStartEndE-ValueType
MYSc 29 205 2.18e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000020837
SMART Domains Protein: ENSMUSP00000020837
Gene: ENSMUSG00000020527

DomainStartEndE-ValueType
MYSc 29 205 2.18e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000093969
SMART Domains Protein: ENSMUSP00000091502
Gene: ENSMUSG00000020527

DomainStartEndE-ValueType
MYSc 29 759 4.07e-219 SMART
IQ 760 782 1.74e1 SMART
IQ 783 804 1.97e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000093969
SMART Domains Protein: ENSMUSP00000091502
Gene: ENSMUSG00000020527

DomainStartEndE-ValueType
MYSc 29 759 4.07e-219 SMART
IQ 760 782 1.74e1 SMART
IQ 783 804 1.97e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000093969
SMART Domains Protein: ENSMUSP00000091502
Gene: ENSMUSG00000020527

DomainStartEndE-ValueType
MYSc 29 759 4.07e-219 SMART
IQ 760 782 1.74e1 SMART
IQ 783 804 1.97e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000093969
SMART Domains Protein: ENSMUSP00000091502
Gene: ENSMUSG00000020527

DomainStartEndE-ValueType
MYSc 29 759 4.07e-219 SMART
IQ 760 782 1.74e1 SMART
IQ 783 804 1.97e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174903
Meta Mutation Damage Score 0.9511 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T G 15: 60,919,633 (GRCm38) probably benign Het
Abcg4 T G 9: 44,277,649 (GRCm38) probably benign Het
Afm C A 5: 90,545,384 (GRCm38) probably benign Het
Ahrr G A 13: 74,283,024 (GRCm38) probably benign Het
Aplnr T A 2: 85,137,276 (GRCm38) probably null Het
Arih2 T A 9: 108,611,727 (GRCm38) H264L probably damaging Het
Atp1a1 A T 3: 101,579,835 (GRCm38) I886N possibly damaging Het
Bmf A T 2: 118,549,622 (GRCm38) V14E probably damaging Het
Ccdc116 T C 16: 17,144,039 (GRCm38) E15G probably damaging Het
Ccdc175 T C 12: 72,135,965 (GRCm38) N427D possibly damaging Het
Cfap53 A G 18: 74,299,176 (GRCm38) H45R probably benign Het
Chd3 A G 11: 69,349,906 (GRCm38) L1569P probably damaging Het
Cntn2 G A 1: 132,516,180 (GRCm38) Q457* probably null Het
Coro1a A T 7: 126,701,413 (GRCm38) probably benign Het
Cracr2b T A 7: 141,463,759 (GRCm38) L91Q probably damaging Het
Ctdspl T C 9: 119,020,046 (GRCm38) probably null Het
Dip2b T A 15: 100,169,312 (GRCm38) L565Q probably damaging Het
Dip2c T A 13: 9,621,903 (GRCm38) C1004S probably damaging Het
Dnah11 A T 12: 118,045,522 (GRCm38) I2135N possibly damaging Het
Dnah14 A G 1: 181,769,407 (GRCm38) probably benign Het
Dnase1 T C 16: 4,038,946 (GRCm38) V147A probably damaging Het
Dusp8 T C 7: 142,082,054 (GRCm38) probably benign Het
Fer1l6 T C 15: 58,662,787 (GRCm38) Y1828H probably damaging Het
Flvcr1 A G 1: 191,008,191 (GRCm38) V544A probably benign Het
Fsd1l T C 4: 53,687,209 (GRCm38) V311A probably benign Het
Glud1 G A 14: 34,334,268 (GRCm38) G300S probably benign Het
Gm4847 C T 1: 166,630,486 (GRCm38) V433I probably benign Het
Gstm3 T G 3: 107,967,840 (GRCm38) Y62S probably damaging Het
Gtse1 C T 15: 85,862,435 (GRCm38) P151S probably benign Het
Herc2 T C 7: 56,207,812 (GRCm38) S4048P probably benign Het
Hp1bp3 T A 4: 138,221,683 (GRCm38) I19K probably benign Het
Htr7 C A 19: 36,041,540 (GRCm38) probably benign Het
Il1a C T 2: 129,309,074 (GRCm38) D10N probably damaging Het
Il22ra2 A T 10: 19,624,458 (GRCm38) N39I probably damaging Het
Kcnn4 T C 7: 24,379,255 (GRCm38) C267R possibly damaging Het
Larp1 A G 11: 58,055,473 (GRCm38) K879R possibly damaging Het
Lcn5 T A 2: 25,661,405 (GRCm38) probably benign Het
Lep T A 6: 29,068,972 (GRCm38) C7* probably null Het
Magi2 A T 5: 20,611,055 (GRCm38) Y747F probably benign Het
Mast4 T C 13: 102,742,058 (GRCm38) T1223A probably damaging Het
Mcc C T 18: 44,445,933 (GRCm38) E803K probably damaging Het
Mtmr4 T C 11: 87,611,508 (GRCm38) I796T probably benign Het
Myef2 A T 2: 125,108,978 (GRCm38) D312E probably benign Het
Myl3 A C 9: 110,767,929 (GRCm38) D119A probably damaging Het
Naa15 T G 3: 51,470,219 (GRCm38) H763Q probably damaging Het
Pde5a C T 3: 122,824,902 (GRCm38) probably benign Het
Plpp2 C T 10: 79,527,244 (GRCm38) R184H probably benign Het
Rab19 T G 6: 39,389,687 (GRCm38) L179V probably damaging Het
Rims2 T A 15: 39,534,966 (GRCm38) M1087K probably damaging Het
Riox2 C A 16: 59,489,367 (GRCm38) D361E probably benign Het
Sh3rf1 T A 8: 61,226,293 (GRCm38) V123E probably damaging Het
Slc35e1 A T 8: 72,484,709 (GRCm38) N318K probably damaging Het
Slc9a2 A T 1: 40,763,602 (GRCm38) E604V probably benign Het
Srp72 T C 5: 76,987,885 (GRCm38) S221P probably damaging Het
Tbx19 A T 1: 165,160,520 (GRCm38) S15T possibly damaging Het
Tcea2 A G 2: 181,685,817 (GRCm38) T112A probably benign Het
Tesk1 T A 4: 43,445,368 (GRCm38) D230E probably damaging Het
Tm4sf5 C T 11: 70,510,712 (GRCm38) A179V probably damaging Het
Tnr G T 1: 159,852,416 (GRCm38) G320V probably damaging Het
Trappc11 A T 8: 47,503,320 (GRCm38) C874S possibly damaging Het
Trpm3 T A 19: 22,914,446 (GRCm38) Y885N probably damaging Het
Unc5a T A 13: 55,002,879 (GRCm38) C505S probably damaging Het
Vmn1r28 G A 6: 58,265,717 (GRCm38) A182T probably benign Het
Xpo5 T C 17: 46,204,786 (GRCm38) probably benign Het
Zfp637 C A 6: 117,845,668 (GRCm38) H252Q probably damaging Het
Zfp646 T A 7: 127,880,731 (GRCm38) D693E probably damaging Het
Other mutations in Myo19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Myo19 APN 11 84,909,498 (GRCm38) missense probably benign 0.00
IGL01120:Myo19 APN 11 84,907,278 (GRCm38) missense probably damaging 0.96
IGL01542:Myo19 APN 11 84,909,546 (GRCm38) missense probably damaging 0.96
IGL02341:Myo19 APN 11 84,888,045 (GRCm38) splice site probably benign
IGL02708:Myo19 APN 11 84,899,396 (GRCm38) missense possibly damaging 0.89
IGL03223:Myo19 APN 11 84,910,471 (GRCm38) missense possibly damaging 0.57
BB004:Myo19 UTSW 11 84,900,220 (GRCm38) missense probably damaging 1.00
BB014:Myo19 UTSW 11 84,900,220 (GRCm38) missense probably damaging 1.00
R0125:Myo19 UTSW 11 84,888,175 (GRCm38) splice site probably benign
R0142:Myo19 UTSW 11 84,894,603 (GRCm38) missense probably damaging 1.00
R0226:Myo19 UTSW 11 84,897,732 (GRCm38) splice site probably benign
R0230:Myo19 UTSW 11 84,893,333 (GRCm38) missense possibly damaging 0.91
R0482:Myo19 UTSW 11 84,909,419 (GRCm38) missense probably benign 0.00
R1981:Myo19 UTSW 11 84,892,170 (GRCm38) missense possibly damaging 0.46
R2035:Myo19 UTSW 11 84,897,608 (GRCm38) missense probably benign
R2185:Myo19 UTSW 11 84,892,221 (GRCm38) missense probably benign 0.00
R3176:Myo19 UTSW 11 84,892,175 (GRCm38) missense probably benign 0.01
R3276:Myo19 UTSW 11 84,892,175 (GRCm38) missense probably benign 0.01
R3824:Myo19 UTSW 11 84,885,679 (GRCm38) missense probably damaging 0.98
R3914:Myo19 UTSW 11 84,894,603 (GRCm38) missense probably damaging 1.00
R4333:Myo19 UTSW 11 84,908,288 (GRCm38) missense probably benign 0.00
R4335:Myo19 UTSW 11 84,908,288 (GRCm38) missense probably benign 0.00
R4647:Myo19 UTSW 11 84,894,642 (GRCm38) missense probably damaging 1.00
R4968:Myo19 UTSW 11 84,901,502 (GRCm38) missense probably damaging 1.00
R4971:Myo19 UTSW 11 84,892,197 (GRCm38) missense probably damaging 1.00
R5083:Myo19 UTSW 11 84,903,211 (GRCm38) missense possibly damaging 0.60
R5284:Myo19 UTSW 11 84,885,272 (GRCm38) splice site probably null
R5558:Myo19 UTSW 11 84,910,448 (GRCm38) missense probably damaging 1.00
R5739:Myo19 UTSW 11 84,897,624 (GRCm38) missense probably damaging 1.00
R5982:Myo19 UTSW 11 84,899,400 (GRCm38) missense probably damaging 0.97
R6093:Myo19 UTSW 11 84,885,709 (GRCm38) missense probably damaging 1.00
R6444:Myo19 UTSW 11 84,895,308 (GRCm38) missense probably benign
R6657:Myo19 UTSW 11 84,897,196 (GRCm38) missense probably benign
R6945:Myo19 UTSW 11 84,897,560 (GRCm38) missense probably benign 0.06
R7022:Myo19 UTSW 11 84,900,547 (GRCm38) missense probably damaging 0.99
R7058:Myo19 UTSW 11 84,907,368 (GRCm38) missense possibly damaging 0.89
R7150:Myo19 UTSW 11 84,905,613 (GRCm38) missense probably benign
R7155:Myo19 UTSW 11 84,900,586 (GRCm38) missense probably damaging 1.00
R7478:Myo19 UTSW 11 84,885,800 (GRCm38) missense probably benign 0.41
R7486:Myo19 UTSW 11 84,905,637 (GRCm38) missense probably benign
R7833:Myo19 UTSW 11 84,909,267 (GRCm38) missense probably benign
R7921:Myo19 UTSW 11 84,908,238 (GRCm38) missense possibly damaging 0.55
R7923:Myo19 UTSW 11 84,885,710 (GRCm38) missense possibly damaging 0.87
R7927:Myo19 UTSW 11 84,900,220 (GRCm38) missense probably damaging 1.00
R9105:Myo19 UTSW 11 84,903,203 (GRCm38) missense probably damaging 0.99
R9714:Myo19 UTSW 11 84,882,716 (GRCm38) start codon destroyed probably null 0.18
X0053:Myo19 UTSW 11 84,897,715 (GRCm38) nonsense probably null
Z1176:Myo19 UTSW 11 84,909,350 (GRCm38) frame shift probably null
Z1176:Myo19 UTSW 11 84,885,278 (GRCm38) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGGCTGTCATTGAATCGCTCACTC -3'
(R):5'- GACTCCCTGACCGCTGTTTCTAAAG -3'

Sequencing Primer
(F):5'- TTGAATCGCTCACTCTTGAAAACC -3'
(R):5'- atttgcctgcctctgcc -3'
Posted On 2013-05-23