Incidental Mutation 'R5311:Ubash3a'
ID404871
Institutional Source Beutler Lab
Gene Symbol Ubash3a
Ensembl Gene ENSMUSG00000042345
Gene Nameubiquitin associated and SH3 domain containing, A
Synonyms5830413C03Rik, Sts-2, TULA
MMRRC Submission 042894-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5311 (G1)
Quality Score211
Status Not validated
Chromosome17
Chromosomal Location31207873-31242202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31219717 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 287 (T287A)
Ref Sequence ENSEMBL: ENSMUSP00000045890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048656] [ENSMUST00000144772]
PDB Structure
Crystal structure of the 2H-phosphatase domain of Sts-2 [X-RAY DIFFRACTION]
Crystal structure of the 2H-phosphatase domain of Sts-2 in complex with tungstate. [X-RAY DIFFRACTION]
Crystal structure of the 2H-phosphatase domain of Sts-2 in complex with phosphate [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000048656
AA Change: T287A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045890
Gene: ENSMUSG00000042345
AA Change: T287A

DomainStartEndE-ValueType
Pfam:UBA 23 57 2.6e-7 PFAM
SH3 241 302 5.53e-10 SMART
Pfam:His_Phos_1 402 601 6.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144772
SMART Domains Protein: ENSMUSP00000119279
Gene: ENSMUSG00000042345

DomainStartEndE-ValueType
Pfam:UBA 21 57 8.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151620
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two family members belonging to the T-cell ubiquitin ligand (TULA) family. Both family members can negatively regulate T-cell signaling. This family member can facilitate growth factor withdrawal-induced apoptosis in T cells, which may occur via its interaction with AIF, an apoptosis-inducing factor. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable and healthy with no abnormalities detected in any of the hematopoietic lineages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5z1 A G 5: 142,467,687 K137E possibly damaging Het
Atm A C 9: 53,518,623 V371G probably benign Het
Cacna2d3 A G 14: 29,347,030 Y247H probably damaging Het
Ccdc180 T C 4: 45,917,556 V927A probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Edar G A 10: 58,607,435 P290S possibly damaging Het
Ext2 T C 2: 93,696,261 I677V probably benign Het
Fam53a A G 5: 33,607,736 S209P probably damaging Het
Fshr A T 17: 89,011,013 probably null Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gm14295 A T 2: 176,810,672 I652L probably benign Het
Gm14403 AAACCCTA AA 2: 177,509,655 probably benign Het
Gm5431 T A 11: 48,888,889 E402V probably damaging Het
Gm6899 GGAGGCCGCCCAGTGGCAGAGGCCGCCCAGTGGCAGAGGC GGAGGCCGCCCAGTGGCAGAGGC 11: 26,593,725 probably null Het
Itih2 T C 2: 10,110,535 D342G probably benign Het
Lgi2 A T 5: 52,554,485 D164E probably damaging Het
Lrriq1 A G 10: 103,214,587 I768T probably damaging Het
Map1a C A 2: 121,302,387 A990E probably damaging Het
Mdh1b A G 1: 63,720,004 V143A probably benign Het
Mrgprb3 C T 7: 48,643,311 C164Y probably damaging Het
Mtpap T A 18: 4,386,328 V316E probably damaging Het
Mybpc3 T A 2: 91,128,678 C655* probably null Het
Myh15 A G 16: 49,165,841 E1558G possibly damaging Het
Mylk A G 16: 34,921,757 T880A probably benign Het
Nckap1 T A 2: 80,540,122 D408V probably damaging Het
Nos3 A T 5: 24,377,345 H605L probably benign Het
Nrxn2 C A 19: 6,531,398 D411E probably benign Het
Olfr1057 T A 2: 86,374,750 I221L possibly damaging Het
Olfr366 T C 2: 37,219,621 V44A probably benign Het
Pde4d C A 13: 109,632,864 P29T probably benign Het
Pde4d C T 13: 109,632,865 P29L probably benign Het
Pkhd1 A G 1: 20,565,870 V412A possibly damaging Het
Rev1 T A 1: 38,079,393 I480L probably benign Het
Rimbp3 A G 16: 17,210,844 T711A probably benign Het
RP23-191E1.1 T A 3: 106,297,468 noncoding transcript Het
Serpina11 A T 12: 103,985,962 I183N probably damaging Het
Siglec1 T C 2: 131,079,316 H645R probably damaging Het
Skint7 G A 4: 111,980,304 R93H probably damaging Het
Slfn8 T C 11: 83,004,084 E632G probably damaging Het
Tmem8b G A 4: 43,673,992 V208I probably benign Het
Trps1 G A 15: 50,664,760 T658I probably damaging Het
Ugt2b35 G A 5: 87,011,280 W444* probably null Het
Vmn1r219 T A 13: 23,162,893 V84D probably damaging Het
Vmn2r10 T C 5: 109,006,255 Y61C probably damaging Het
Vmn2r104 G A 17: 20,029,901 P703S probably damaging Het
Wdsub1 T A 2: 59,878,529 probably benign Het
Zfp667 A G 7: 6,305,716 Q461R probably benign Het
Zfp941 C A 7: 140,811,959 G496* probably null Het
Other mutations in Ubash3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Ubash3a APN 17 31228186 missense probably benign
IGL01310:Ubash3a APN 17 31215142 missense probably benign 0.03
IGL01450:Ubash3a APN 17 31208231 missense probably damaging 1.00
IGL02429:Ubash3a APN 17 31241305 missense probably benign 0.00
IGL02458:Ubash3a APN 17 31231481 missense possibly damaging 0.94
IGL03014:Ubash3a UTSW 17 31239224 missense probably damaging 1.00
R1033:Ubash3a UTSW 17 31208212 missense probably damaging 1.00
R1700:Ubash3a UTSW 17 31215044 missense probably damaging 0.99
R2212:Ubash3a UTSW 17 31218034 missense probably damaging 1.00
R3800:Ubash3a UTSW 17 31231470 missense probably benign 0.24
R4125:Ubash3a UTSW 17 31237275 missense probably damaging 1.00
R4127:Ubash3a UTSW 17 31237275 missense probably damaging 1.00
R4128:Ubash3a UTSW 17 31237275 missense probably damaging 1.00
R4224:Ubash3a UTSW 17 31237928 missense probably damaging 1.00
R4786:Ubash3a UTSW 17 31217964 missense probably benign 0.31
R5782:Ubash3a UTSW 17 31235503 missense probably benign 0.05
R5804:Ubash3a UTSW 17 31208232 critical splice donor site probably null
R6244:Ubash3a UTSW 17 31239272 missense possibly damaging 0.90
R6263:Ubash3a UTSW 17 31215095 missense probably benign 0.22
R6574:Ubash3a UTSW 17 31232396 missense probably damaging 1.00
R6736:Ubash3a UTSW 17 31231415 missense probably benign
R7041:Ubash3a UTSW 17 31228210 missense probably benign 0.00
R7458:Ubash3a UTSW 17 31208165 missense probably benign 0.02
R7490:Ubash3a UTSW 17 31232312 missense probably damaging 1.00
R7991:Ubash3a UTSW 17 31237895 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- AGAACCCTCACTAAGACGTGG -3'
(R):5'- TAGATCAGATGTTTGCCATGCAC -3'

Sequencing Primer
(F):5'- ACGTGGGTCTCCTGCCTC -3'
(R):5'- AGATGTTTGCCATGCACACTGG -3'
Posted On2016-07-22