Incidental Mutation 'R5322:Olfr1018'
ID404882
Institutional Source Beutler Lab
Gene Symbol Olfr1018
Ensembl Gene ENSMUSG00000043892
Gene Nameolfactory receptor 1018
SynonymsGA_x6K02T2Q125-47301584-47302519, MOR260-5
MMRRC Submission 042905-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5322 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location85818479-85824221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85823187 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 72 (I72N)
Ref Sequence ENSEMBL: ENSMUSP00000151090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054201] [ENSMUST00000214416]
Predicted Effect probably damaging
Transcript: ENSMUST00000054201
AA Change: I72N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000050833
Gene: ENSMUSG00000043892
AA Change: I72N

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 4.1e-59 PFAM
Pfam:7tm_1 42 291 1.2e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214416
AA Change: I72N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A G 9: 94,520,562 I349T probably benign Het
Adamts3 C T 5: 89,707,300 probably null Het
Ankar T C 1: 72,690,386 probably null Het
Ankrd60 T A 2: 173,568,817 K303N possibly damaging Het
Appbp2 A G 11: 85,196,064 probably null Het
Arvcf T C 16: 18,397,643 M176T probably benign Het
Cachd1 T C 4: 100,952,122 I268T probably damaging Het
Ccdc66 A G 14: 27,482,527 S933P probably damaging Het
Cfi C T 3: 129,873,040 P471S probably damaging Het
Ckmt2 G T 13: 91,861,772 T143K possibly damaging Het
Cnksr3 A T 10: 7,135,078 D15E probably damaging Het
Copb2 A T 9: 98,585,976 K680N probably benign Het
D2hgdh T C 1: 93,829,898 probably null Het
Dcn A T 10: 97,517,602 T338S probably benign Het
Dnah10 G A 5: 124,773,566 G1644D probably damaging Het
Dnah5 A G 15: 28,384,244 I3045V probably benign Het
Dock3 G A 9: 106,901,829 T307I probably benign Het
Dock5 A T 14: 67,770,266 I1498N probably benign Het
Emc1 A T 4: 139,354,246 N62Y probably damaging Het
Enpp6 C A 8: 47,068,915 H295N probably benign Het
Epha10 A G 4: 124,885,748 Y129C probably damaging Het
Fbn2 A T 18: 58,039,315 D2139E probably benign Het
Fbxl12 A T 9: 20,639,008 V140E probably damaging Het
Fignl1 A T 11: 11,801,571 F495I probably damaging Het
Gm43302 C T 5: 105,217,481 A554T probably benign Het
Gpr157 A G 4: 150,098,852 N160D probably benign Het
Il1rn G A 2: 24,348,629 probably null Het
Kctd13 T A 7: 126,929,206 L51Q probably damaging Het
Kndc1 T C 7: 139,936,809 F1561L probably damaging Het
Mast2 A G 4: 116,333,411 probably null Het
Mib1 A G 18: 10,792,975 H637R probably damaging Het
Moxd1 A T 10: 24,244,253 N93I possibly damaging Het
Mycbp2 T C 14: 103,185,683 probably null Het
Myot T C 18: 44,354,149 F351S probably benign Het
N4bp2 T A 5: 65,790,457 N143K possibly damaging Het
Olfr147 A T 9: 38,403,566 I228F probably damaging Het
Olfr243 T A 7: 103,717,112 W173R probably benign Het
Olfr455 T C 6: 42,539,016 D2G probably benign Het
Olfr623 T C 7: 103,660,672 I193V possibly damaging Het
Olfr666 C T 7: 104,893,164 V155I probably benign Het
Olfr917 T A 9: 38,665,206 I213L probably benign Het
Patl1 C T 19: 11,920,859 R134* probably null Het
Paxbp1 T C 16: 91,015,162 I887V probably benign Het
Pi4kb G A 3: 94,994,249 R436Q probably benign Het
Pla2g3 A G 11: 3,488,686 E112G probably benign Het
Ppp2r2a A G 14: 67,038,873 probably null Het
Rela T A 19: 5,645,380 S311R possibly damaging Het
Sidt1 T A 16: 44,281,622 probably benign Het
Smco2 T C 6: 146,871,287 L329P probably damaging Het
Speer4f1 A T 5: 17,477,349 I77F possibly damaging Het
Tex14 A G 11: 87,511,472 I462V probably benign Het
Tmem260 C T 14: 48,486,849 R385W probably damaging Het
Trrap T C 5: 144,844,224 V2974A probably damaging Het
Usp47 C T 7: 112,053,269 T31I probably damaging Het
Zc2hc1a A G 3: 7,551,421 N247S probably benign Het
Zeb2 A C 2: 44,997,095 M582R probably damaging Het
Other mutations in Olfr1018
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Olfr1018 APN 2 85822988 missense probably benign 0.00
IGL02795:Olfr1018 APN 2 85823512 nonsense probably null
IGL03189:Olfr1018 APN 2 85823558 missense probably benign 0.27
IGL03329:Olfr1018 APN 2 85823385 missense probably benign 0.02
IGL03400:Olfr1018 APN 2 85823750 missense probably damaging 1.00
IGL02796:Olfr1018 UTSW 2 85823589 missense probably benign 0.00
R5597:Olfr1018 UTSW 2 85823460 missense probably damaging 0.96
R6521:Olfr1018 UTSW 2 85823450 missense probably benign 0.01
R6725:Olfr1018 UTSW 2 85823790 missense probably damaging 0.97
R7068:Olfr1018 UTSW 2 85823052 missense probably benign 0.00
R7105:Olfr1018 UTSW 2 85823880 missense probably benign 0.22
R8011:Olfr1018 UTSW 2 85823613 missense possibly damaging 0.90
Z1176:Olfr1018 UTSW 2 85823021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGGCTTTCATCTGATCC -3'
(R):5'- AAATGGCTGCCAGTTGGATACAG -3'

Sequencing Primer
(F):5'- ATCTGATCCCAAGGTACAGCTGG -3'
(R):5'- TGGTCCATAATAACAGTGTAGTGG -3'
Posted On2016-07-22