Incidental Mutation 'R5322:Dock5'
ID 404926
Institutional Source Beutler Lab
Gene Symbol Dock5
Ensembl Gene ENSMUSG00000044447
Gene Name dedicator of cytokinesis 5
Synonyms lr2, 1110060D06Rik, rlc
MMRRC Submission 042905-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.321) question?
Stock # R5322 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 67752135-67933442 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 67770266 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 1498 (I1498N)
Ref Sequence ENSEMBL: ENSMUSP00000036674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039135]
AlphaFold B2RY04
Predicted Effect probably benign
Transcript: ENSMUST00000039135
AA Change: I1498N

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447
AA Change: I1498N

DomainStartEndE-ValueType
SH3 11 68 1.45e-13 SMART
Pfam:DOCK_N 71 434 9e-110 PFAM
Pfam:DOCK-C2 439 636 1.1e-57 PFAM
low complexity region 752 764 N/A INTRINSIC
Pfam:DHR-2 1133 1635 6.4e-99 PFAM
low complexity region 1663 1692 N/A INTRINSIC
low complexity region 1815 1824 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A G 9: 94,520,562 I349T probably benign Het
Adamts3 C T 5: 89,707,300 probably null Het
Ankar T C 1: 72,690,386 probably null Het
Ankrd60 T A 2: 173,568,817 K303N possibly damaging Het
Appbp2 A G 11: 85,196,064 probably null Het
Arvcf T C 16: 18,397,643 M176T probably benign Het
Cachd1 T C 4: 100,952,122 I268T probably damaging Het
Ccdc66 A G 14: 27,482,527 S933P probably damaging Het
Cfi C T 3: 129,873,040 P471S probably damaging Het
Ckmt2 G T 13: 91,861,772 T143K possibly damaging Het
Cnksr3 A T 10: 7,135,078 D15E probably damaging Het
Copb2 A T 9: 98,585,976 K680N probably benign Het
D2hgdh T C 1: 93,829,898 probably null Het
Dcn A T 10: 97,517,602 T338S probably benign Het
Dnah10 G A 5: 124,773,566 G1644D probably damaging Het
Dnah5 A G 15: 28,384,244 I3045V probably benign Het
Dock3 G A 9: 106,901,829 T307I probably benign Het
Emc1 A T 4: 139,354,246 N62Y probably damaging Het
Enpp6 C A 8: 47,068,915 H295N probably benign Het
Epha10 A G 4: 124,885,748 Y129C probably damaging Het
Fbn2 A T 18: 58,039,315 D2139E probably benign Het
Fbxl12 A T 9: 20,639,008 V140E probably damaging Het
Fignl1 A T 11: 11,801,571 F495I probably damaging Het
Gm43302 C T 5: 105,217,481 A554T probably benign Het
Gpr157 A G 4: 150,098,852 N160D probably benign Het
Il1rn G A 2: 24,348,629 probably null Het
Kctd13 T A 7: 126,929,206 L51Q probably damaging Het
Kndc1 T C 7: 139,936,809 F1561L probably damaging Het
Mast2 A G 4: 116,333,411 probably null Het
Mib1 A G 18: 10,792,975 H637R probably damaging Het
Moxd1 A T 10: 24,244,253 N93I possibly damaging Het
Mycbp2 T C 14: 103,185,683 probably null Het
Myot T C 18: 44,354,149 F351S probably benign Het
N4bp2 T A 5: 65,790,457 N143K possibly damaging Het
Olfr1018 T A 2: 85,823,187 I72N probably damaging Het
Olfr147 A T 9: 38,403,566 I228F probably damaging Het
Olfr243 T A 7: 103,717,112 W173R probably benign Het
Olfr455 T C 6: 42,539,016 D2G probably benign Het
Olfr623 T C 7: 103,660,672 I193V possibly damaging Het
Olfr666 C T 7: 104,893,164 V155I probably benign Het
Olfr917 T A 9: 38,665,206 I213L probably benign Het
Patl1 C T 19: 11,920,859 R134* probably null Het
Paxbp1 T C 16: 91,015,162 I887V probably benign Het
Pi4kb G A 3: 94,994,249 R436Q probably benign Het
Pla2g3 A G 11: 3,488,686 E112G probably benign Het
Ppp2r2a A G 14: 67,038,873 probably null Het
Rela T A 19: 5,645,380 S311R possibly damaging Het
Sidt1 T A 16: 44,281,622 probably benign Het
Smco2 T C 6: 146,871,287 L329P probably damaging Het
Speer4f1 A T 5: 17,477,349 I77F possibly damaging Het
Tex14 A G 11: 87,511,472 I462V probably benign Het
Tmem260 C T 14: 48,486,849 R385W probably damaging Het
Trrap T C 5: 144,844,224 V2974A probably damaging Het
Usp47 C T 7: 112,053,269 T31I probably damaging Het
Zc2hc1a A G 3: 7,551,421 N247S probably benign Het
Zeb2 A C 2: 44,997,095 M582R probably damaging Het
Other mutations in Dock5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Dock5 APN 14 67786889 splice site probably benign
IGL00930:Dock5 APN 14 67771077 missense probably damaging 1.00
IGL01525:Dock5 APN 14 67805720 splice site probably benign
IGL01759:Dock5 APN 14 67881259 nonsense probably null
IGL01941:Dock5 APN 14 67812232 missense probably damaging 1.00
IGL02025:Dock5 APN 14 67763287 missense probably damaging 1.00
IGL02093:Dock5 APN 14 67839543 splice site probably benign
IGL02179:Dock5 APN 14 67806496 splice site probably benign
IGL02208:Dock5 APN 14 67828450 missense probably benign 0.06
IGL02605:Dock5 APN 14 67828438 missense probably benign 0.18
IGL02608:Dock5 APN 14 67828439 missense probably benign 0.01
IGL02938:Dock5 APN 14 67757218 splice site probably benign
IGL02971:Dock5 APN 14 67757109 missense probably null 1.00
IGL02983:Dock5 APN 14 67764670 missense probably damaging 1.00
IGL03151:Dock5 APN 14 67866067 missense probably damaging 1.00
IGL03410:Dock5 APN 14 67846086 missense probably benign 0.04
PIT4366001:Dock5 UTSW 14 67824674 missense possibly damaging 0.83
R0026:Dock5 UTSW 14 67846081 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0112:Dock5 UTSW 14 67819641 missense probably benign
R0127:Dock5 UTSW 14 67846042 missense probably benign 0.13
R0144:Dock5 UTSW 14 67786286 missense probably benign 0.18
R0312:Dock5 UTSW 14 67795991 missense possibly damaging 0.82
R0360:Dock5 UTSW 14 67822680 splice site probably benign
R0364:Dock5 UTSW 14 67822680 splice site probably benign
R0496:Dock5 UTSW 14 67817518 missense probably damaging 1.00
R0506:Dock5 UTSW 14 67784792 splice site probably benign
R0586:Dock5 UTSW 14 67809032 missense probably damaging 1.00
R0597:Dock5 UTSW 14 67784934 splice site probably null
R0625:Dock5 UTSW 14 67841163 missense probably benign
R1109:Dock5 UTSW 14 67806478 missense possibly damaging 0.80
R1221:Dock5 UTSW 14 67759161 missense probably benign 0.00
R1278:Dock5 UTSW 14 67839566 missense possibly damaging 0.80
R1927:Dock5 UTSW 14 67846062 missense possibly damaging 0.60
R1944:Dock5 UTSW 14 67757135 nonsense probably null
R1946:Dock5 UTSW 14 67786316 missense probably damaging 1.00
R2046:Dock5 UTSW 14 67812142 missense probably benign
R2101:Dock5 UTSW 14 67794010 missense probably benign 0.02
R2252:Dock5 UTSW 14 67784812 missense probably damaging 0.98
R2882:Dock5 UTSW 14 67839620 missense probably damaging 0.99
R3110:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R3112:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R4236:Dock5 UTSW 14 67756492 missense probably benign 0.02
R4242:Dock5 UTSW 14 67828490 missense probably benign 0.19
R4244:Dock5 UTSW 14 67774582 missense probably benign 0.41
R4646:Dock5 UTSW 14 67842779 missense probably benign 0.01
R4793:Dock5 UTSW 14 67800354 missense probably benign 0.26
R4841:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R4842:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R5159:Dock5 UTSW 14 67792289 missense probably benign 0.04
R5164:Dock5 UTSW 14 67817661 nonsense probably null
R5206:Dock5 UTSW 14 67763184 missense probably benign 0.35
R5207:Dock5 UTSW 14 67776284 missense probably benign 0.06
R5374:Dock5 UTSW 14 67805756 missense possibly damaging 0.81
R5413:Dock5 UTSW 14 67764655 missense probably damaging 1.00
R5476:Dock5 UTSW 14 67814007 missense possibly damaging 0.92
R5504:Dock5 UTSW 14 67803086 missense probably benign 0.01
R5677:Dock5 UTSW 14 67777603 missense probably benign 0.00
R5773:Dock5 UTSW 14 67796058 missense possibly damaging 0.95
R5845:Dock5 UTSW 14 67841101 missense possibly damaging 0.82
R5957:Dock5 UTSW 14 67857994 missense probably benign
R6154:Dock5 UTSW 14 67859912 missense probably benign 0.03
R6268:Dock5 UTSW 14 67790275 nonsense probably null
R6393:Dock5 UTSW 14 67822602 missense probably benign 0.32
R6512:Dock5 UTSW 14 67824648 missense possibly damaging 0.93
R6759:Dock5 UTSW 14 67795996 missense probably benign 0.00
R7012:Dock5 UTSW 14 67822586 missense probably damaging 1.00
R7061:Dock5 UTSW 14 67770254 missense probably damaging 0.96
R7196:Dock5 UTSW 14 67756470 missense probably damaging 1.00
R7200:Dock5 UTSW 14 67771702 nonsense probably null
R7311:Dock5 UTSW 14 67828502 missense probably benign 0.25
R7359:Dock5 UTSW 14 67765888 missense probably benign 0.10
R7422:Dock5 UTSW 14 67809030 missense probably benign 0.01
R7588:Dock5 UTSW 14 67763158 critical splice donor site probably null
R7637:Dock5 UTSW 14 67786340 missense possibly damaging 0.95
R7709:Dock5 UTSW 14 67796005 missense probably benign 0.44
R7763:Dock5 UTSW 14 67821327 missense probably damaging 0.97
R8044:Dock5 UTSW 14 67824692 missense probably damaging 1.00
R8076:Dock5 UTSW 14 67802977 splice site probably null
R8168:Dock5 UTSW 14 67770197 splice site probably null
R8353:Dock5 UTSW 14 67817508 splice site probably null
R8480:Dock5 UTSW 14 67836410 missense probably benign 0.32
R8535:Dock5 UTSW 14 67793976 missense probably benign 0.19
R8708:Dock5 UTSW 14 67767371 missense probably benign 0.02
R8732:Dock5 UTSW 14 67846000 missense possibly damaging 0.85
R8888:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8895:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8936:Dock5 UTSW 14 67845990 nonsense probably null
R8962:Dock5 UTSW 14 67757191 missense probably benign
R8972:Dock5 UTSW 14 67776300 missense probably damaging 1.00
R9244:Dock5 UTSW 14 67759114 missense probably damaging 0.99
R9345:Dock5 UTSW 14 67822622 missense possibly damaging 0.74
R9679:Dock5 UTSW 14 67781001 missense probably damaging 1.00
X0023:Dock5 UTSW 14 67771088 missense probably benign 0.15
Z1177:Dock5 UTSW 14 67813933 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ACAAGTGTGCTCTTTATTCCGC -3'
(R):5'- CACTCCCTAGAAGACATGTGAG -3'

Sequencing Primer
(F):5'- AGCCAAGCTGGTGCAGG -3'
(R):5'- GAATGGAGTCTCACCAGCTG -3'
Posted On 2016-07-22