Incidental Mutation 'R5322:Mib1'
ID404933
Institutional Source Beutler Lab
Gene Symbol Mib1
Ensembl Gene ENSMUSG00000024294
Gene Namemindbomb E3 ubiquitin protein ligase 1
SynonymsMib, mind bomb-1, skeletrophin, E430019M12Rik
MMRRC Submission 042905-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5322 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location10725548-10818704 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10792975 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 637 (H637R)
Ref Sequence ENSEMBL: ENSMUSP00000131712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052838] [ENSMUST00000165555]
Predicted Effect probably damaging
Transcript: ENSMUST00000052838
AA Change: H637R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054428
Gene: ENSMUSG00000024294
AA Change: H637R

DomainStartEndE-ValueType
Pfam:MIB_HERC2 15 72 5.6e-21 PFAM
ZnF_ZZ 79 124 1.01e-10 SMART
Pfam:MIB_HERC2 154 219 4.9e-31 PFAM
ANK 430 460 1.63e3 SMART
ANK 463 492 2.1e-3 SMART
ANK 496 525 2.47e2 SMART
ANK 529 558 6.02e-4 SMART
ANK 562 591 1.14e-4 SMART
ANK 595 626 6.26e-2 SMART
ANK 631 661 1.24e-5 SMART
ANK 665 694 9.27e-5 SMART
ANK 698 729 1.04e2 SMART
RING 819 853 1.8e-1 SMART
RING 866 900 1.9e-1 SMART
RING 963 995 4.58e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000124288
AA Change: H271R
SMART Domains Protein: ENSMUSP00000114289
Gene: ENSMUSG00000024294
AA Change: H271R

DomainStartEndE-ValueType
ANK 65 95 1.63e3 SMART
ANK 98 127 2.1e-3 SMART
ANK 131 160 2.47e2 SMART
ANK 164 193 6.02e-4 SMART
ANK 197 226 1.14e-4 SMART
ANK 230 261 6.26e-2 SMART
ANK 266 296 1.24e-5 SMART
ANK 300 329 9.27e-5 SMART
ANK 333 364 1.04e2 SMART
RING 454 488 1.8e-1 SMART
RING 501 535 1.9e-1 SMART
RING 598 630 4.58e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165555
AA Change: H637R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131712
Gene: ENSMUSG00000024294
AA Change: H637R

DomainStartEndE-ValueType
Pfam:MIB_HERC2 15 74 5.7e-25 PFAM
ZnF_ZZ 79 124 1.01e-10 SMART
Pfam:MIB_HERC2 154 221 5.5e-31 PFAM
ANK 430 460 1.63e3 SMART
ANK 463 492 2.1e-3 SMART
ANK 496 525 2.47e2 SMART
ANK 529 558 6.02e-4 SMART
ANK 562 591 1.14e-4 SMART
ANK 595 626 6.26e-2 SMART
ANK 631 661 1.24e-5 SMART
ANK 665 694 9.27e-5 SMART
ANK 698 729 1.04e2 SMART
RING 819 853 1.8e-1 SMART
RING 866 900 1.9e-1 SMART
RING 963 995 4.58e-4 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin repeats and RING finger domains that functions as an E3 ubiquitin ligase. The encoded protein positively regulates Notch signaling by ubiquitinating the Notch receptors, thereby facilitating their endocytosis. This protein may also promote the ubiquitination and degradation of death-associated protein kinase 1 (DAPK1). [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, failure of heart looping, impaired angiogenesis and arterial specification, premature neuronal precursor differentiation, posterior truncation, and abnormal somitogenesis with loss ofposterior markers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A G 9: 94,520,562 I349T probably benign Het
Adamts3 C T 5: 89,707,300 probably null Het
Ankar T C 1: 72,690,386 probably null Het
Ankrd60 T A 2: 173,568,817 K303N possibly damaging Het
Appbp2 A G 11: 85,196,064 probably null Het
Arvcf T C 16: 18,397,643 M176T probably benign Het
Cachd1 T C 4: 100,952,122 I268T probably damaging Het
Ccdc66 A G 14: 27,482,527 S933P probably damaging Het
Cfi C T 3: 129,873,040 P471S probably damaging Het
Ckmt2 G T 13: 91,861,772 T143K possibly damaging Het
Cnksr3 A T 10: 7,135,078 D15E probably damaging Het
Copb2 A T 9: 98,585,976 K680N probably benign Het
D2hgdh T C 1: 93,829,898 probably null Het
Dcn A T 10: 97,517,602 T338S probably benign Het
Dnah10 G A 5: 124,773,566 G1644D probably damaging Het
Dnah5 A G 15: 28,384,244 I3045V probably benign Het
Dock3 G A 9: 106,901,829 T307I probably benign Het
Dock5 A T 14: 67,770,266 I1498N probably benign Het
Emc1 A T 4: 139,354,246 N62Y probably damaging Het
Enpp6 C A 8: 47,068,915 H295N probably benign Het
Epha10 A G 4: 124,885,748 Y129C probably damaging Het
Fbn2 A T 18: 58,039,315 D2139E probably benign Het
Fbxl12 A T 9: 20,639,008 V140E probably damaging Het
Fignl1 A T 11: 11,801,571 F495I probably damaging Het
Gm43302 C T 5: 105,217,481 A554T probably benign Het
Gpr157 A G 4: 150,098,852 N160D probably benign Het
Il1rn G A 2: 24,348,629 probably null Het
Kctd13 T A 7: 126,929,206 L51Q probably damaging Het
Kndc1 T C 7: 139,936,809 F1561L probably damaging Het
Mast2 A G 4: 116,333,411 probably null Het
Moxd1 A T 10: 24,244,253 N93I possibly damaging Het
Mycbp2 T C 14: 103,185,683 probably null Het
Myot T C 18: 44,354,149 F351S probably benign Het
N4bp2 T A 5: 65,790,457 N143K possibly damaging Het
Olfr1018 T A 2: 85,823,187 I72N probably damaging Het
Olfr147 A T 9: 38,403,566 I228F probably damaging Het
Olfr243 T A 7: 103,717,112 W173R probably benign Het
Olfr455 T C 6: 42,539,016 D2G probably benign Het
Olfr623 T C 7: 103,660,672 I193V possibly damaging Het
Olfr666 C T 7: 104,893,164 V155I probably benign Het
Olfr917 T A 9: 38,665,206 I213L probably benign Het
Patl1 C T 19: 11,920,859 R134* probably null Het
Paxbp1 T C 16: 91,015,162 I887V probably benign Het
Pi4kb G A 3: 94,994,249 R436Q probably benign Het
Pla2g3 A G 11: 3,488,686 E112G probably benign Het
Ppp2r2a A G 14: 67,038,873 probably null Het
Rela T A 19: 5,645,380 S311R possibly damaging Het
Sidt1 T A 16: 44,281,622 probably benign Het
Smco2 T C 6: 146,871,287 L329P probably damaging Het
Speer4f1 A T 5: 17,477,349 I77F possibly damaging Het
Tex14 A G 11: 87,511,472 I462V probably benign Het
Tmem260 C T 14: 48,486,849 R385W probably damaging Het
Trrap T C 5: 144,844,224 V2974A probably damaging Het
Usp47 C T 7: 112,053,269 T31I probably damaging Het
Zc2hc1a A G 3: 7,551,421 N247S probably benign Het
Zeb2 A C 2: 44,997,095 M582R probably damaging Het
Other mutations in Mib1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Mib1 APN 18 10798490 missense probably benign 0.02
IGL02300:Mib1 APN 18 10741016 missense probably damaging 1.00
IGL02701:Mib1 APN 18 10747357 missense probably damaging 0.98
IGL02731:Mib1 APN 18 10800115 missense possibly damaging 0.81
IGL03002:Mib1 APN 18 10798356 missense possibly damaging 0.87
IGL03083:Mib1 APN 18 10752029 critical splice donor site probably null
PIT4466001:Mib1 UTSW 18 10775541 missense probably benign 0.01
PIT4468001:Mib1 UTSW 18 10798463 missense possibly damaging 0.86
R0496:Mib1 UTSW 18 10804773 missense probably benign
R1015:Mib1 UTSW 18 10726409 missense probably damaging 1.00
R1237:Mib1 UTSW 18 10768149 missense probably damaging 1.00
R1557:Mib1 UTSW 18 10798474 missense probably damaging 1.00
R1918:Mib1 UTSW 18 10740972 splice site probably null
R1952:Mib1 UTSW 18 10812077 missense possibly damaging 0.94
R1982:Mib1 UTSW 18 10812064 missense probably damaging 1.00
R2009:Mib1 UTSW 18 10812118 missense probably damaging 1.00
R2372:Mib1 UTSW 18 10812045 missense probably damaging 1.00
R2422:Mib1 UTSW 18 10751906 missense probably damaging 1.00
R2922:Mib1 UTSW 18 10760831 nonsense probably null
R2923:Mib1 UTSW 18 10760831 nonsense probably null
R2938:Mib1 UTSW 18 10752033 splice site probably benign
R3814:Mib1 UTSW 18 10763281 missense probably benign 0.09
R3858:Mib1 UTSW 18 10798409 missense possibly damaging 0.56
R4356:Mib1 UTSW 18 10751844 missense probably benign 0.03
R4357:Mib1 UTSW 18 10751844 missense probably benign 0.03
R4358:Mib1 UTSW 18 10751844 missense probably benign 0.03
R4406:Mib1 UTSW 18 10763289 missense probably damaging 1.00
R4497:Mib1 UTSW 18 10811985 missense possibly damaging 0.75
R4593:Mib1 UTSW 18 10768191 missense possibly damaging 0.89
R4623:Mib1 UTSW 18 10808086 missense probably benign 0.02
R5068:Mib1 UTSW 18 10793002 missense probably damaging 0.99
R5069:Mib1 UTSW 18 10793002 missense probably damaging 0.99
R5070:Mib1 UTSW 18 10793002 missense probably damaging 0.99
R5258:Mib1 UTSW 18 10795856 splice site probably null
R5589:Mib1 UTSW 18 10794488 missense probably benign 0.00
R5622:Mib1 UTSW 18 10794503 missense possibly damaging 0.90
R6401:Mib1 UTSW 18 10795802 missense probably benign
R6928:Mib1 UTSW 18 10802282 missense probably benign 0.02
R7242:Mib1 UTSW 18 10741011 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCCTGTGTGTACAAACATG -3'
(R):5'- AGTATTAGAGCGAGGCTGGC -3'

Sequencing Primer
(F):5'- GCCTGTGTGTACAAACATGATTTTC -3'
(R):5'- ACCTCCAAGTGTCTGATGATG -3'
Posted On2016-07-22