Incidental Mutation 'R5323:Ush2a'
ID 404943
Institutional Source Beutler Lab
Gene Symbol Ush2a
Ensembl Gene ENSMUSG00000026609
Gene Name usherin
Synonyms MUSH2A, LOC269160, LOC381317, Ushrn, Ush2a, A930037M10Rik, A930011D15Rik
MMRRC Submission 042906-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.501) question?
Stock # R5323 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 187995035-188697694 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to T at 188553874 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000050454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060479]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000060479
SMART Domains Protein: ENSMUSP00000050454
Gene: ENSMUSG00000026609

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:Laminin_G_3 128 283 6.5e-16 PFAM
LamNT 310 513 6.79e-9 SMART
EGF_Lam 515 569 1.58e-3 SMART
EGF_Lam 572 635 5.69e-10 SMART
EGF_Lam 638 688 4.38e-11 SMART
EGF_Lam 691 741 3.56e-11 SMART
EGF_Lam 744 789 7.93e-9 SMART
EGF_Lam 792 841 3.37e-12 SMART
EGF_Lam 844 894 2.01e-10 SMART
EGF_Lam 897 945 5.43e-16 SMART
EGF_Lam 948 996 7.88e-4 SMART
EGF_Lam 999 1047 2.96e-8 SMART
FN3 1051 1130 1e-1 SMART
FN3 1145 1224 2.06e-3 SMART
FN3 1239 1342 8.69e-11 SMART
FN3 1356 1447 5.32e-6 SMART
FN3 1461 1570 2.63e1 SMART
LamG 1531 1672 5.39e-19 SMART
LamG 1727 1862 2.33e-23 SMART
FN3 1861 1931 9.15e1 SMART
FN3 1945 2032 2.24e-4 SMART
FN3 2047 2120 1.13e0 SMART
FN3 2134 2218 3.4e-4 SMART
FN3 2232 2306 1.59e-4 SMART
FN3 2320 2412 1.12e-4 SMART
FN3 2423 2510 8.9e-8 SMART
FN3 2524 2600 1.95e-4 SMART
FN3 2612 2701 4.67e-2 SMART
FN3 2715 2792 1.17e-7 SMART
FN3 2809 2902 1.12e-4 SMART
FN3 2913 2997 5.36e-2 SMART
FN3 3011 3089 2.46e-1 SMART
FN3 3101 3477 2.85e1 SMART
FN3 3491 3568 4e-1 SMART
FN3 3582 3659 5.87e-8 SMART
FN3 3673 3750 1.75e-6 SMART
FN3 3764 3845 9.62e-4 SMART
FN3 3859 3943 2.41e-4 SMART
FN3 3954 4044 5.11e-8 SMART
FN3 4058 4133 1.06e0 SMART
FN3 4147 4241 7.87e-9 SMART
FN3 4255 4334 1.15e-1 SMART
FN3 4348 4422 6.39e-9 SMART
FN3 4435 4510 6.91e-5 SMART
FN3 4521 4610 2.28e-5 SMART
FN3 4626 4713 1.71e0 SMART
FN3 4724 4805 1.3e0 SMART
FN3 4817 4909 3.62e-8 SMART
transmembrane domain 5032 5054 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains laminin EGF motifs, a pentaxin domain, and many fibronectin type III motifs. The protein is found in the basement membrane, and may be important in development and homeostasis of the inner ear and retina. Mutations within this gene have been associated with Usher syndrome type IIa and retinitis pigmentosa. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display progressive retinal photoreceptor degeneration along with significantly reduced a- and b-wave amplitudes, and a moderate but nonprogressive high-frequency hearing loss associated with widespread loss of outer hair cells in the basal turn of the cochlea. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T A 7: 82,206,269 (GRCm39) C784S probably damaging Het
Ahnak2 A T 12: 112,745,989 (GRCm39) probably benign Het
Apon A G 10: 128,090,907 (GRCm39) E195G probably damaging Het
Atxn10 A G 15: 85,275,944 (GRCm39) I334V probably benign Het
Camsap1 G T 2: 25,855,823 (GRCm39) A145E probably damaging Het
Capns1 G T 7: 29,887,147 (GRCm39) F243L possibly damaging Het
Catsper2 A T 2: 121,237,216 (GRCm39) I228N probably damaging Het
Ceacam14 A T 7: 17,549,402 (GRCm39) *264C probably null Het
Cel A C 2: 28,450,530 (GRCm39) V165G probably damaging Het
Cldnd1 T A 16: 58,550,016 (GRCm39) D66E possibly damaging Het
Cntnap5b T A 1: 100,311,275 (GRCm39) C589* probably null Het
Dnah3 T A 7: 119,620,234 (GRCm39) H1554L probably damaging Het
Fbxw25 T A 9: 109,492,573 (GRCm39) M55L probably benign Het
Fn1 T C 1: 71,636,591 (GRCm39) H2187R probably benign Het
Fsip2 A G 2: 82,818,489 (GRCm39) T4741A possibly damaging Het
Gabpa T A 16: 84,653,934 (GRCm39) I272N possibly damaging Het
Ganab T C 19: 8,886,049 (GRCm39) S212P probably benign Het
Ggt1 A G 10: 75,421,495 (GRCm39) probably null Het
Hpgds T C 6: 65,109,169 (GRCm39) T81A probably benign Het
Insr G A 8: 3,252,902 (GRCm39) T419I probably benign Het
Itgb7 A G 15: 102,140,059 (GRCm39) probably benign Het
Kcnt1 A G 2: 25,799,289 (GRCm39) I951V possibly damaging Het
Lrrc4c T A 2: 97,460,498 (GRCm39) C375S probably damaging Het
Muc17 G T 5: 137,175,537 (GRCm39) C44* probably null Het
Mycbpap A T 11: 94,394,330 (GRCm39) D313E probably benign Het
Neo1 A G 9: 58,813,931 (GRCm39) probably null Het
Ntsr2 C T 12: 16,709,934 (GRCm39) S405F probably benign Het
Nup153 G A 13: 46,870,682 (GRCm39) P21S probably benign Het
Obscn T A 11: 58,887,703 (GRCm39) E7705D probably benign Het
Ogn A G 13: 49,762,817 (GRCm39) D53G probably benign Het
Or10d5j A T 9: 39,868,125 (GRCm39) Y35* probably null Het
Or14j10 A T 17: 37,935,046 (GRCm39) I160K probably benign Het
Or5k8 G A 16: 58,645,066 (GRCm39) T2I probably benign Het
Or5p5 T C 7: 107,413,883 (GRCm39) F33L possibly damaging Het
Or9i1b A T 19: 13,896,980 (GRCm39) I199F possibly damaging Het
Pde6a G A 18: 61,365,983 (GRCm39) R236H possibly damaging Het
Pigk T A 3: 152,443,837 (GRCm39) M85K probably damaging Het
Pirb A C 7: 3,719,598 (GRCm39) I516S possibly damaging Het
Polr3a T C 14: 24,505,009 (GRCm39) I1084V possibly damaging Het
Pum2 T A 12: 8,794,706 (GRCm39) I737N probably damaging Het
Recql5 A T 11: 115,818,215 (GRCm39) C159S probably damaging Het
Rxrg A G 1: 167,452,573 (GRCm39) N125S probably benign Het
Sgip1 C A 4: 102,823,477 (GRCm39) N699K probably damaging Het
Shprh G A 10: 11,046,041 (GRCm39) probably null Het
Smcp C T 3: 92,491,454 (GRCm39) G131D unknown Het
St8sia6 A G 2: 13,798,188 (GRCm39) L23P possibly damaging Het
Stk32c T A 7: 138,699,276 (GRCm39) T335S probably benign Het
Stox1 G A 10: 62,499,812 (GRCm39) A916V possibly damaging Het
Syk A T 13: 52,785,753 (GRCm39) T297S probably benign Het
Tert G T 13: 73,796,490 (GRCm39) A1074S probably benign Het
Tex9 A T 9: 72,385,187 (GRCm39) D135E probably damaging Het
Tmem132a G A 19: 10,841,371 (GRCm39) H318Y possibly damaging Het
Ttn A G 2: 76,738,249 (GRCm39) S4097P probably benign Het
Usp36 A T 11: 118,156,020 (GRCm39) S586T probably benign Het
Vsig8 A G 1: 172,388,244 (GRCm39) S71G probably benign Het
Zfp318 G A 17: 46,697,662 (GRCm39) D173N probably damaging Het
Zfp638 T A 6: 83,939,076 (GRCm39) S936T probably damaging Het
Zic2 A G 14: 122,713,728 (GRCm39) Y214C probably damaging Het
Other mutations in Ush2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ush2a APN 1 188,596,875 (GRCm39) missense probably benign 0.00
IGL00391:Ush2a APN 1 188,648,258 (GRCm39) missense probably damaging 1.00
IGL00429:Ush2a APN 1 188,132,311 (GRCm39) nonsense probably null
IGL00484:Ush2a APN 1 188,514,710 (GRCm39) missense probably benign 0.00
IGL00519:Ush2a APN 1 188,176,865 (GRCm39) missense probably benign 0.03
IGL00567:Ush2a APN 1 188,697,114 (GRCm39) missense probably damaging 1.00
IGL00823:Ush2a APN 1 188,643,640 (GRCm39) missense possibly damaging 0.61
IGL00940:Ush2a APN 1 188,090,158 (GRCm39) nonsense probably null
IGL00951:Ush2a APN 1 187,995,662 (GRCm39) missense probably benign 0.33
IGL00956:Ush2a APN 1 188,485,719 (GRCm39) missense probably damaging 0.99
IGL01096:Ush2a APN 1 188,410,574 (GRCm39) missense probably damaging 1.00
IGL01108:Ush2a APN 1 188,595,022 (GRCm39) missense probably benign 0.00
IGL01315:Ush2a APN 1 188,365,811 (GRCm39) missense possibly damaging 0.51
IGL01318:Ush2a APN 1 188,546,550 (GRCm39) missense probably benign 0.00
IGL01324:Ush2a APN 1 188,581,189 (GRCm39) missense probably benign 0.38
IGL01326:Ush2a APN 1 187,995,518 (GRCm39) nonsense probably null
IGL01384:Ush2a APN 1 188,285,425 (GRCm39) missense possibly damaging 0.65
IGL01466:Ush2a APN 1 188,643,819 (GRCm39) missense probably benign 0.00
IGL01518:Ush2a APN 1 188,131,982 (GRCm39) missense probably benign 0.01
IGL01585:Ush2a APN 1 188,162,924 (GRCm39) missense probably damaging 1.00
IGL01595:Ush2a APN 1 188,386,921 (GRCm39) critical splice donor site probably null
IGL01657:Ush2a APN 1 188,558,658 (GRCm39) missense probably benign 0.03
IGL01797:Ush2a APN 1 187,995,706 (GRCm39) missense probably damaging 1.00
IGL01802:Ush2a APN 1 188,169,154 (GRCm39) missense probably damaging 0.99
IGL01836:Ush2a APN 1 188,492,060 (GRCm39) splice site probably benign
IGL01938:Ush2a APN 1 188,530,042 (GRCm39) missense probably damaging 1.00
IGL01976:Ush2a APN 1 188,643,438 (GRCm39) missense probably benign 0.04
IGL02023:Ush2a APN 1 188,465,711 (GRCm39) missense probably benign 0.03
IGL02126:Ush2a APN 1 187,995,588 (GRCm39) missense probably benign 0.01
IGL02133:Ush2a APN 1 188,175,540 (GRCm39) missense probably damaging 1.00
IGL02147:Ush2a APN 1 188,596,900 (GRCm39) missense probably benign
IGL02275:Ush2a APN 1 187,995,466 (GRCm39) missense possibly damaging 0.67
IGL02314:Ush2a APN 1 188,365,826 (GRCm39) missense probably benign 0.00
IGL02353:Ush2a APN 1 188,460,635 (GRCm39) missense probably benign 0.04
IGL02360:Ush2a APN 1 188,460,635 (GRCm39) missense probably benign 0.04
IGL02367:Ush2a APN 1 188,516,943 (GRCm39) missense probably benign
IGL02402:Ush2a APN 1 187,999,305 (GRCm39) missense probably benign 0.02
IGL02410:Ush2a APN 1 188,648,194 (GRCm39) missense probably damaging 1.00
IGL02490:Ush2a APN 1 188,542,561 (GRCm39) missense probably damaging 1.00
IGL02500:Ush2a APN 1 188,554,893 (GRCm39) missense probably damaging 1.00
IGL02511:Ush2a APN 1 188,475,884 (GRCm39) critical splice donor site probably null
IGL02517:Ush2a APN 1 188,648,195 (GRCm39) missense probably damaging 1.00
IGL02536:Ush2a APN 1 188,689,463 (GRCm39) critical splice acceptor site probably null
IGL02585:Ush2a APN 1 188,460,530 (GRCm39) missense probably benign 0.00
IGL02610:Ush2a APN 1 188,176,663 (GRCm39) missense probably damaging 0.98
IGL02677:Ush2a APN 1 188,466,882 (GRCm39) missense probably damaging 1.00
IGL02691:Ush2a APN 1 188,466,949 (GRCm39) missense probably damaging 1.00
IGL02740:Ush2a APN 1 188,380,585 (GRCm39) missense possibly damaging 0.68
IGL02744:Ush2a APN 1 188,090,914 (GRCm39) splice site probably null
IGL02749:Ush2a APN 1 188,679,155 (GRCm39) missense probably damaging 0.99
IGL02806:Ush2a APN 1 188,542,554 (GRCm39) nonsense probably null
IGL02870:Ush2a APN 1 188,410,555 (GRCm39) missense probably benign 0.42
IGL02894:Ush2a APN 1 188,184,043 (GRCm39) missense probably damaging 1.00
IGL02904:Ush2a APN 1 188,638,703 (GRCm39) missense probably benign 0.06
IGL03000:Ush2a APN 1 188,282,053 (GRCm39) missense possibly damaging 0.81
IGL03015:Ush2a APN 1 188,169,147 (GRCm39) missense probably benign 0.01
IGL03036:Ush2a APN 1 188,596,818 (GRCm39) missense possibly damaging 0.80
IGL03057:Ush2a APN 1 188,530,035 (GRCm39) missense probably damaging 1.00
IGL03230:Ush2a APN 1 188,198,390 (GRCm39) missense probably benign 0.09
IGL03278:Ush2a APN 1 188,581,313 (GRCm39) missense probably damaging 1.00
BB003:Ush2a UTSW 1 188,460,797 (GRCm39) missense probably benign
BB013:Ush2a UTSW 1 188,460,797 (GRCm39) missense probably benign
PIT4283001:Ush2a UTSW 1 188,169,064 (GRCm39) missense probably benign 0.01
R0003:Ush2a UTSW 1 188,310,688 (GRCm39) missense probably damaging 0.99
R0030:Ush2a UTSW 1 188,554,854 (GRCm39) missense possibly damaging 0.51
R0035:Ush2a UTSW 1 188,089,085 (GRCm39) missense probably benign
R0038:Ush2a UTSW 1 188,358,809 (GRCm39) missense probably benign 0.00
R0038:Ush2a UTSW 1 188,358,809 (GRCm39) missense probably benign 0.00
R0067:Ush2a UTSW 1 188,697,043 (GRCm39) missense probably damaging 0.99
R0067:Ush2a UTSW 1 188,697,043 (GRCm39) missense probably damaging 0.99
R0103:Ush2a UTSW 1 188,051,267 (GRCm39) missense possibly damaging 0.81
R0103:Ush2a UTSW 1 188,051,267 (GRCm39) missense possibly damaging 0.81
R0122:Ush2a UTSW 1 188,680,652 (GRCm39) missense possibly damaging 0.65
R0206:Ush2a UTSW 1 188,263,958 (GRCm39) missense probably damaging 0.99
R0208:Ush2a UTSW 1 188,263,958 (GRCm39) missense probably damaging 0.99
R0230:Ush2a UTSW 1 188,582,301 (GRCm39) missense probably damaging 1.00
R0269:Ush2a UTSW 1 188,542,373 (GRCm39) missense probably benign 0.33
R0319:Ush2a UTSW 1 188,680,571 (GRCm39) splice site probably benign
R0358:Ush2a UTSW 1 188,269,977 (GRCm39) missense possibly damaging 0.83
R0379:Ush2a UTSW 1 188,184,016 (GRCm39) missense probably damaging 1.00
R0427:Ush2a UTSW 1 188,132,478 (GRCm39) missense probably damaging 1.00
R0437:Ush2a UTSW 1 188,643,228 (GRCm39) missense probably benign 0.00
R0462:Ush2a UTSW 1 188,643,136 (GRCm39) missense probably benign
R0510:Ush2a UTSW 1 188,466,860 (GRCm39) splice site probably benign
R0531:Ush2a UTSW 1 188,175,378 (GRCm39) missense probably benign 0.18
R0541:Ush2a UTSW 1 188,446,663 (GRCm39) splice site probably benign
R0549:Ush2a UTSW 1 188,679,150 (GRCm39) missense probably damaging 0.99
R0562:Ush2a UTSW 1 188,089,044 (GRCm39) missense probably damaging 1.00
R0636:Ush2a UTSW 1 188,554,935 (GRCm39) missense probably benign
R0662:Ush2a UTSW 1 188,083,290 (GRCm39) missense probably benign 0.26
R0685:Ush2a UTSW 1 188,132,475 (GRCm39) missense probably damaging 1.00
R0718:Ush2a UTSW 1 188,530,027 (GRCm39) missense probably damaging 1.00
R0725:Ush2a UTSW 1 188,683,722 (GRCm39) missense probably damaging 1.00
R0735:Ush2a UTSW 1 188,596,890 (GRCm39) missense probably benign 0.04
R0744:Ush2a UTSW 1 188,546,603 (GRCm39) splice site probably benign
R0765:Ush2a UTSW 1 188,680,771 (GRCm39) missense possibly damaging 0.67
R0862:Ush2a UTSW 1 188,275,015 (GRCm39) nonsense probably null
R1067:Ush2a UTSW 1 188,282,404 (GRCm39) missense probably benign 0.35
R1072:Ush2a UTSW 1 188,460,914 (GRCm39) missense possibly damaging 0.91
R1099:Ush2a UTSW 1 188,596,836 (GRCm39) missense probably damaging 1.00
R1099:Ush2a UTSW 1 188,380,545 (GRCm39) missense probably benign 0.06
R1104:Ush2a UTSW 1 188,648,453 (GRCm39) missense probably benign
R1106:Ush2a UTSW 1 188,643,180 (GRCm39) missense possibly damaging 0.82
R1124:Ush2a UTSW 1 188,485,733 (GRCm39) missense probably damaging 0.99
R1168:Ush2a UTSW 1 188,410,608 (GRCm39) missense probably benign 0.01
R1199:Ush2a UTSW 1 188,491,992 (GRCm39) missense probably benign 0.00
R1215:Ush2a UTSW 1 188,689,479 (GRCm39) missense possibly damaging 0.66
R1307:Ush2a UTSW 1 188,184,037 (GRCm39) missense probably damaging 1.00
R1307:Ush2a UTSW 1 188,090,164 (GRCm39) missense probably damaging 1.00
R1311:Ush2a UTSW 1 188,679,342 (GRCm39) missense possibly damaging 0.86
R1388:Ush2a UTSW 1 188,255,515 (GRCm39) splice site probably benign
R1416:Ush2a UTSW 1 188,169,080 (GRCm39) missense probably damaging 1.00
R1424:Ush2a UTSW 1 188,275,075 (GRCm39) critical splice donor site probably null
R1459:Ush2a UTSW 1 188,595,048 (GRCm39) missense probably benign 0.05
R1470:Ush2a UTSW 1 188,132,403 (GRCm39) missense probably benign 0.00
R1470:Ush2a UTSW 1 188,132,403 (GRCm39) missense probably benign 0.00
R1477:Ush2a UTSW 1 188,581,273 (GRCm39) missense probably benign 0.05
R1484:Ush2a UTSW 1 188,542,534 (GRCm39) nonsense probably null
R1490:Ush2a UTSW 1 188,092,038 (GRCm39) missense probably benign 0.24
R1510:Ush2a UTSW 1 188,380,501 (GRCm39) missense probably damaging 1.00
R1522:Ush2a UTSW 1 188,530,011 (GRCm39) missense possibly damaging 0.94
R1606:Ush2a UTSW 1 188,491,963 (GRCm39) missense probably benign 0.17
R1618:Ush2a UTSW 1 188,546,421 (GRCm39) missense probably benign 0.29
R1636:Ush2a UTSW 1 188,198,373 (GRCm39) missense possibly damaging 0.53
R1646:Ush2a UTSW 1 188,148,018 (GRCm39) missense probably damaging 1.00
R1660:Ush2a UTSW 1 188,648,261 (GRCm39) missense probably benign
R1676:Ush2a UTSW 1 188,460,782 (GRCm39) missense probably damaging 1.00
R1704:Ush2a UTSW 1 188,553,993 (GRCm39) missense probably damaging 1.00
R1705:Ush2a UTSW 1 188,643,738 (GRCm39) missense probably benign 0.40
R1705:Ush2a UTSW 1 188,607,066 (GRCm39) missense probably damaging 1.00
R1760:Ush2a UTSW 1 188,643,180 (GRCm39) missense possibly damaging 0.82
R1776:Ush2a UTSW 1 188,460,400 (GRCm39) missense possibly damaging 0.83
R1782:Ush2a UTSW 1 188,643,382 (GRCm39) missense probably benign 0.06
R1794:Ush2a UTSW 1 188,595,006 (GRCm39) missense probably benign 0.00
R1796:Ush2a UTSW 1 188,643,024 (GRCm39) missense probably benign 0.11
R1804:Ush2a UTSW 1 188,365,926 (GRCm39) critical splice donor site probably null
R1835:Ush2a UTSW 1 188,184,015 (GRCm39) missense probably benign 0.13
R1871:Ush2a UTSW 1 188,558,665 (GRCm39) missense probably benign 0.02
R1876:Ush2a UTSW 1 188,410,486 (GRCm39) missense possibly damaging 0.51
R1887:Ush2a UTSW 1 188,132,177 (GRCm39) missense probably benign 0.05
R1896:Ush2a UTSW 1 188,282,206 (GRCm39) missense probably benign 0.00
R1907:Ush2a UTSW 1 188,447,261 (GRCm39) missense probably benign 0.01
R1940:Ush2a UTSW 1 188,683,758 (GRCm39) missense probably null 0.89
R1950:Ush2a UTSW 1 188,487,382 (GRCm39) missense probably damaging 1.00
R1991:Ush2a UTSW 1 188,310,729 (GRCm39) splice site probably benign
R2043:Ush2a UTSW 1 188,648,453 (GRCm39) missense probably benign 0.00
R2046:Ush2a UTSW 1 188,089,124 (GRCm39) missense probably benign 0.01
R2059:Ush2a UTSW 1 188,113,746 (GRCm39) critical splice donor site probably null
R2239:Ush2a UTSW 1 188,308,411 (GRCm39) missense probably benign
R2365:Ush2a UTSW 1 188,111,188 (GRCm39) missense possibly damaging 0.68
R2395:Ush2a UTSW 1 188,679,237 (GRCm39) missense probably damaging 1.00
R2425:Ush2a UTSW 1 188,270,001 (GRCm39) missense possibly damaging 0.82
R2519:Ush2a UTSW 1 187,999,304 (GRCm39) missense probably benign
R3039:Ush2a UTSW 1 188,643,744 (GRCm39) missense probably damaging 0.99
R3434:Ush2a UTSW 1 188,465,955 (GRCm39) missense probably damaging 1.00
R3711:Ush2a UTSW 1 188,542,489 (GRCm39) missense probably benign 0.05
R3712:Ush2a UTSW 1 188,542,489 (GRCm39) missense probably benign 0.05
R3732:Ush2a UTSW 1 188,676,957 (GRCm39) missense probably benign 0.16
R3746:Ush2a UTSW 1 188,542,489 (GRCm39) missense probably benign 0.05
R3747:Ush2a UTSW 1 188,542,489 (GRCm39) missense probably benign 0.05
R3883:Ush2a UTSW 1 187,995,579 (GRCm39) missense probably benign
R3911:Ush2a UTSW 1 188,132,151 (GRCm39) missense probably benign 0.05
R3934:Ush2a UTSW 1 187,995,708 (GRCm39) critical splice donor site probably null
R3946:Ush2a UTSW 1 188,460,701 (GRCm39) missense probably benign 0.01
R3974:Ush2a UTSW 1 188,113,698 (GRCm39) missense probably benign 0.06
R4158:Ush2a UTSW 1 188,460,907 (GRCm39) missense probably damaging 1.00
R4159:Ush2a UTSW 1 188,460,907 (GRCm39) missense probably damaging 1.00
R4161:Ush2a UTSW 1 188,460,907 (GRCm39) missense probably damaging 1.00
R4162:Ush2a UTSW 1 188,475,877 (GRCm39) missense probably benign 0.00
R4255:Ush2a UTSW 1 188,492,040 (GRCm39) nonsense probably null
R4280:Ush2a UTSW 1 188,310,658 (GRCm39) missense probably benign 0.16
R4387:Ush2a UTSW 1 188,175,628 (GRCm39) missense probably benign 0.00
R4416:Ush2a UTSW 1 188,089,071 (GRCm39) missense probably damaging 0.97
R4494:Ush2a UTSW 1 188,285,473 (GRCm39) missense possibly damaging 0.50
R4505:Ush2a UTSW 1 188,460,793 (GRCm39) missense possibly damaging 0.92
R4522:Ush2a UTSW 1 188,596,822 (GRCm39) missense probably damaging 1.00
R4584:Ush2a UTSW 1 188,183,995 (GRCm39) missense probably benign 0.00
R4599:Ush2a UTSW 1 188,643,844 (GRCm39) missense probably benign 0.01
R4605:Ush2a UTSW 1 188,642,998 (GRCm39) missense probably damaging 1.00
R4632:Ush2a UTSW 1 188,128,071 (GRCm39) missense possibly damaging 0.82
R4688:Ush2a UTSW 1 188,132,138 (GRCm39) missense probably benign 0.01
R4751:Ush2a UTSW 1 188,582,284 (GRCm39) missense probably damaging 0.98
R4770:Ush2a UTSW 1 188,282,076 (GRCm39) missense probably benign 0.25
R4771:Ush2a UTSW 1 188,529,966 (GRCm39) missense possibly damaging 0.92
R4798:Ush2a UTSW 1 188,475,742 (GRCm39) missense probably damaging 1.00
R4821:Ush2a UTSW 1 188,485,848 (GRCm39) missense probably benign 0.32
R4857:Ush2a UTSW 1 188,269,917 (GRCm39) missense probably benign 0.01
R4860:Ush2a UTSW 1 188,285,472 (GRCm39) missense probably benign 0.07
R4860:Ush2a UTSW 1 188,285,472 (GRCm39) missense probably benign 0.07
R4898:Ush2a UTSW 1 188,358,805 (GRCm39) missense probably benign 0.37
R4993:Ush2a UTSW 1 188,642,917 (GRCm39) missense probably benign 0.03
R5035:Ush2a UTSW 1 188,643,005 (GRCm39) missense probably damaging 1.00
R5061:Ush2a UTSW 1 188,689,471 (GRCm39) missense probably benign 0.03
R5150:Ush2a UTSW 1 188,184,067 (GRCm39) missense possibly damaging 0.95
R5205:Ush2a UTSW 1 188,607,133 (GRCm39) missense probably benign 0.21
R5212:Ush2a UTSW 1 188,176,902 (GRCm39) critical splice donor site probably null
R5252:Ush2a UTSW 1 188,553,914 (GRCm39) missense possibly damaging 0.83
R5260:Ush2a UTSW 1 188,679,276 (GRCm39) missense possibly damaging 0.95
R5304:Ush2a UTSW 1 188,088,995 (GRCm39) missense probably damaging 0.99
R5330:Ush2a UTSW 1 188,460,578 (GRCm39) missense probably benign 0.00
R5331:Ush2a UTSW 1 188,460,578 (GRCm39) missense probably benign 0.00
R5332:Ush2a UTSW 1 188,083,276 (GRCm39) missense probably damaging 1.00
R5371:Ush2a UTSW 1 188,175,267 (GRCm39) missense probably benign 0.00
R5374:Ush2a UTSW 1 188,487,403 (GRCm39) missense probably benign
R5377:Ush2a UTSW 1 188,644,320 (GRCm39) missense probably benign 0.00
R5525:Ush2a UTSW 1 188,485,803 (GRCm39) missense probably benign 0.01
R5558:Ush2a UTSW 1 188,530,024 (GRCm39) missense possibly damaging 0.47
R5562:Ush2a UTSW 1 188,308,414 (GRCm39) missense probably damaging 1.00
R5595:Ush2a UTSW 1 188,638,695 (GRCm39) missense possibly damaging 0.95
R5620:Ush2a UTSW 1 188,492,020 (GRCm39) missense possibly damaging 0.82
R5714:Ush2a UTSW 1 188,132,454 (GRCm39) missense probably benign 0.00
R5743:Ush2a UTSW 1 188,169,159 (GRCm39) missense probably benign 0.01
R5779:Ush2a UTSW 1 188,175,707 (GRCm39) critical splice donor site probably null
R5795:Ush2a UTSW 1 188,175,594 (GRCm39) missense probably benign 0.34
R5897:Ush2a UTSW 1 188,553,935 (GRCm39) missense probably damaging 1.00
R5918:Ush2a UTSW 1 188,089,011 (GRCm39) missense probably benign 0.26
R6000:Ush2a UTSW 1 187,999,223 (GRCm39) nonsense probably null
R6014:Ush2a UTSW 1 188,582,237 (GRCm39) missense probably damaging 0.98
R6017:Ush2a UTSW 1 188,689,711 (GRCm39) critical splice donor site probably null
R6020:Ush2a UTSW 1 188,460,293 (GRCm39) splice site probably null
R6039:Ush2a UTSW 1 188,051,217 (GRCm39) missense possibly damaging 0.76
R6039:Ush2a UTSW 1 188,051,217 (GRCm39) missense possibly damaging 0.76
R6050:Ush2a UTSW 1 188,689,521 (GRCm39) missense probably benign 0.06
R6083:Ush2a UTSW 1 187,999,220 (GRCm39) missense probably damaging 1.00
R6091:Ush2a UTSW 1 188,132,000 (GRCm39) missense probably damaging 1.00
R6120:Ush2a UTSW 1 188,090,800 (GRCm39) missense probably benign 0.04
R6135:Ush2a UTSW 1 188,644,303 (GRCm39) missense possibly damaging 0.68
R6141:Ush2a UTSW 1 188,090,160 (GRCm39) missense possibly damaging 0.71
R6157:Ush2a UTSW 1 188,460,467 (GRCm39) missense probably benign 0.00
R6180:Ush2a UTSW 1 188,132,068 (GRCm39) nonsense probably null
R6191:Ush2a UTSW 1 187,995,298 (GRCm39) nonsense probably null
R6217:Ush2a UTSW 1 188,475,651 (GRCm39) splice site probably null
R6263:Ush2a UTSW 1 188,090,839 (GRCm39) missense probably damaging 1.00
R6294:Ush2a UTSW 1 188,268,567 (GRCm39) missense possibly damaging 0.49
R6320:Ush2a UTSW 1 188,089,043 (GRCm39) missense probably benign 0.01
R6321:Ush2a UTSW 1 188,581,243 (GRCm39) nonsense probably null
R6347:Ush2a UTSW 1 188,643,084 (GRCm39) missense probably benign
R6382:Ush2a UTSW 1 188,546,499 (GRCm39) missense probably benign 0.01
R6408:Ush2a UTSW 1 187,999,229 (GRCm39) nonsense probably null
R6418:Ush2a UTSW 1 188,360,763 (GRCm39) missense probably damaging 1.00
R6500:Ush2a UTSW 1 188,573,724 (GRCm39) missense probably benign 0.00
R6504:Ush2a UTSW 1 188,643,444 (GRCm39) missense probably benign 0.00
R6534:Ush2a UTSW 1 188,183,999 (GRCm39) nonsense probably null
R6594:Ush2a UTSW 1 188,642,995 (GRCm39) missense possibly damaging 0.93
R6612:Ush2a UTSW 1 188,643,594 (GRCm39) missense possibly damaging 0.91
R6645:Ush2a UTSW 1 188,255,528 (GRCm39) missense probably damaging 0.99
R6658:Ush2a UTSW 1 188,546,556 (GRCm39) missense possibly damaging 0.95
R6726:Ush2a UTSW 1 188,485,881 (GRCm39) missense possibly damaging 0.85
R6755:Ush2a UTSW 1 188,175,416 (GRCm39) missense possibly damaging 0.95
R6782:Ush2a UTSW 1 188,089,031 (GRCm39) missense probably benign
R6817:Ush2a UTSW 1 188,595,061 (GRCm39) missense probably benign 0.03
R6834:Ush2a UTSW 1 188,088,989 (GRCm39) missense probably damaging 1.00
R6851:Ush2a UTSW 1 188,265,402 (GRCm39) missense probably benign 0.06
R6853:Ush2a UTSW 1 188,643,434 (GRCm39) nonsense probably null
R6867:Ush2a UTSW 1 188,643,170 (GRCm39) missense probably damaging 1.00
R6889:Ush2a UTSW 1 188,530,068 (GRCm39) missense probably damaging 1.00
R6931:Ush2a UTSW 1 188,460,580 (GRCm39) missense probably benign 0.01
R6953:Ush2a UTSW 1 187,995,342 (GRCm39) missense possibly damaging 0.94
R6966:Ush2a UTSW 1 188,308,441 (GRCm39) missense probably damaging 1.00
R7109:Ush2a UTSW 1 188,113,681 (GRCm39) missense probably benign 0.19
R7153:Ush2a UTSW 1 188,460,681 (GRCm39) missense possibly damaging 0.93
R7176:Ush2a UTSW 1 188,269,925 (GRCm39) missense probably benign 0.00
R7182:Ush2a UTSW 1 188,485,740 (GRCm39) missense probably benign 0.01
R7201:Ush2a UTSW 1 188,606,951 (GRCm39) missense probably benign
R7223:Ush2a UTSW 1 188,542,414 (GRCm39) missense probably benign 0.09
R7231:Ush2a UTSW 1 188,491,960 (GRCm39) missense possibly damaging 0.49
R7240:Ush2a UTSW 1 188,643,858 (GRCm39) missense possibly damaging 0.83
R7263:Ush2a UTSW 1 188,175,526 (GRCm39) missense possibly damaging 0.94
R7329:Ush2a UTSW 1 188,285,395 (GRCm39) missense probably damaging 0.97
R7343:Ush2a UTSW 1 188,147,943 (GRCm39) missense probably benign 0.00
R7352:Ush2a UTSW 1 188,198,321 (GRCm39) missense probably benign 0.04
R7384:Ush2a UTSW 1 188,132,360 (GRCm39) missense probably damaging 0.99
R7391:Ush2a UTSW 1 188,694,205 (GRCm39) small deletion probably benign
R7394:Ush2a UTSW 1 188,643,613 (GRCm39) missense possibly damaging 0.83
R7403:Ush2a UTSW 1 188,365,924 (GRCm39) missense probably damaging 1.00
R7408:Ush2a UTSW 1 188,465,726 (GRCm39) missense probably benign 0.00
R7453:Ush2a UTSW 1 188,285,308 (GRCm39) missense probably damaging 1.00
R7496:Ush2a UTSW 1 188,083,284 (GRCm39) missense possibly damaging 0.50
R7552:Ush2a UTSW 1 187,999,241 (GRCm39) missense possibly damaging 0.65
R7556:Ush2a UTSW 1 188,689,690 (GRCm39) missense probably benign 0.31
R7575:Ush2a UTSW 1 188,554,885 (GRCm39) missense possibly damaging 0.90
R7578:Ush2a UTSW 1 188,282,110 (GRCm39) missense probably damaging 1.00
R7584:Ush2a UTSW 1 188,460,306 (GRCm39) critical splice acceptor site probably null
R7589:Ush2a UTSW 1 188,275,046 (GRCm39) missense probably benign 0.00
R7602:Ush2a UTSW 1 188,380,606 (GRCm39) missense probably damaging 1.00
R7670:Ush2a UTSW 1 188,516,905 (GRCm39) missense possibly damaging 0.78
R7743:Ush2a UTSW 1 188,542,376 (GRCm39) missense probably benign 0.05
R7753:Ush2a UTSW 1 188,175,603 (GRCm39) missense probably benign 0.28
R7767:Ush2a UTSW 1 188,285,457 (GRCm39) missense probably benign 0.01
R7784:Ush2a UTSW 1 188,176,789 (GRCm39) missense possibly damaging 0.55
R7831:Ush2a UTSW 1 188,492,038 (GRCm39) missense probably damaging 0.98
R7834:Ush2a UTSW 1 188,465,637 (GRCm39) nonsense probably null
R7847:Ush2a UTSW 1 188,163,005 (GRCm39) missense probably damaging 1.00
R7926:Ush2a UTSW 1 188,460,797 (GRCm39) missense probably benign
R7969:Ush2a UTSW 1 188,558,568 (GRCm39) missense probably benign 0.02
R7978:Ush2a UTSW 1 188,132,135 (GRCm39) missense probably benign 0.00
R7990:Ush2a UTSW 1 188,274,996 (GRCm39) missense probably benign 0.00
R8001:Ush2a UTSW 1 188,643,261 (GRCm39) missense probably damaging 0.98
R8039:Ush2a UTSW 1 188,689,570 (GRCm39) missense probably damaging 1.00
R8077:Ush2a UTSW 1 188,275,025 (GRCm39) missense probably benign 0.01
R8165:Ush2a UTSW 1 188,183,952 (GRCm39) missense possibly damaging 0.70
R8208:Ush2a UTSW 1 188,606,990 (GRCm39) missense possibly damaging 0.95
R8220:Ush2a UTSW 1 188,460,863 (GRCm39) missense probably damaging 1.00
R8270:Ush2a UTSW 1 188,176,838 (GRCm39) missense probably benign 0.06
R8316:Ush2a UTSW 1 188,178,899 (GRCm39) missense probably benign 0.01
R8347:Ush2a UTSW 1 188,679,281 (GRCm39) missense probably benign 0.02
R8360:Ush2a UTSW 1 188,198,468 (GRCm39) missense probably benign 0.01
R8362:Ush2a UTSW 1 188,689,650 (GRCm39) missense probably damaging 0.96
R8386:Ush2a UTSW 1 188,460,403 (GRCm39) missense possibly damaging 0.80
R8401:Ush2a UTSW 1 188,275,062 (GRCm39) missense probably benign 0.10
R8439:Ush2a UTSW 1 188,582,254 (GRCm39) missense probably damaging 1.00
R8465:Ush2a UTSW 1 188,147,875 (GRCm39) missense probably damaging 1.00
R8478:Ush2a UTSW 1 188,175,429 (GRCm39) missense possibly damaging 0.83
R8540:Ush2a UTSW 1 188,274,858 (GRCm39) missense probably benign 0.00
R8684:Ush2a UTSW 1 188,643,220 (GRCm39) missense possibly damaging 0.45
R8685:Ush2a UTSW 1 188,198,401 (GRCm39) missense probably damaging 1.00
R8699:Ush2a UTSW 1 188,643,574 (GRCm39) missense probably damaging 1.00
R8720:Ush2a UTSW 1 188,090,715 (GRCm39) missense probably benign 0.05
R8754:Ush2a UTSW 1 188,581,162 (GRCm39) nonsense probably null
R8756:Ush2a UTSW 1 188,644,141 (GRCm39) missense possibly damaging 0.91
R8788:Ush2a UTSW 1 188,475,816 (GRCm39) nonsense probably null
R8803:Ush2a UTSW 1 188,676,998 (GRCm39) missense probably benign
R8817:Ush2a UTSW 1 187,995,231 (GRCm39) start codon destroyed probably benign 0.00
R8837:Ush2a UTSW 1 188,485,847 (GRCm39) missense probably benign
R8880:Ush2a UTSW 1 188,460,733 (GRCm39) missense probably benign 0.11
R8902:Ush2a UTSW 1 188,175,281 (GRCm39) missense probably damaging 0.98
R8918:Ush2a UTSW 1 188,270,017 (GRCm39) missense possibly damaging 0.85
R8940:Ush2a UTSW 1 188,132,505 (GRCm39) missense probably benign 0.02
R8968:Ush2a UTSW 1 188,127,956 (GRCm39) missense probably damaging 1.00
R8995:Ush2a UTSW 1 188,176,850 (GRCm39) missense probably damaging 0.98
R9011:Ush2a UTSW 1 188,638,676 (GRCm39) missense probably damaging 0.99
R9037:Ush2a UTSW 1 187,995,487 (GRCm39) missense possibly damaging 0.51
R9063:Ush2a UTSW 1 187,995,457 (GRCm39) missense probably benign 0.00
R9089:Ush2a UTSW 1 188,487,374 (GRCm39) nonsense probably null
R9096:Ush2a UTSW 1 188,198,333 (GRCm39) missense probably benign 0.00
R9118:Ush2a UTSW 1 188,386,839 (GRCm39) missense probably damaging 0.98
R9174:Ush2a UTSW 1 188,460,416 (GRCm39) missense probably damaging 0.99
R9210:Ush2a UTSW 1 188,516,866 (GRCm39) missense probably null 0.01
R9242:Ush2a UTSW 1 188,365,787 (GRCm39) missense probably damaging 1.00
R9321:Ush2a UTSW 1 188,089,148 (GRCm39) missense probably damaging 0.97
R9338:Ush2a UTSW 1 188,308,489 (GRCm39) critical splice donor site probably null
R9357:Ush2a UTSW 1 188,607,147 (GRCm39) missense probably benign 0.01
R9358:Ush2a UTSW 1 188,607,147 (GRCm39) missense probably benign 0.01
R9406:Ush2a UTSW 1 187,995,646 (GRCm39) missense probably benign 0.00
R9407:Ush2a UTSW 1 188,644,045 (GRCm39) missense probably damaging 1.00
R9428:Ush2a UTSW 1 188,175,316 (GRCm39) missense probably damaging 1.00
R9456:Ush2a UTSW 1 188,558,589 (GRCm39) missense probably benign 0.00
R9507:Ush2a UTSW 1 188,596,937 (GRCm39) nonsense probably null
R9509:Ush2a UTSW 1 188,648,440 (GRCm39) missense probably damaging 1.00
R9512:Ush2a UTSW 1 188,643,160 (GRCm39) missense probably damaging 0.99
R9564:Ush2a UTSW 1 188,268,551 (GRCm39) missense possibly damaging 0.90
R9612:Ush2a UTSW 1 188,092,063 (GRCm39) nonsense probably null
R9670:Ush2a UTSW 1 188,360,768 (GRCm39) missense probably benign 0.03
R9684:Ush2a UTSW 1 188,132,078 (GRCm39) missense possibly damaging 0.67
R9798:Ush2a UTSW 1 188,644,002 (GRCm39) missense possibly damaging 0.80
RF017:Ush2a UTSW 1 187,995,666 (GRCm39) missense probably damaging 1.00
U24488:Ush2a UTSW 1 188,162,963 (GRCm39) missense probably damaging 0.99
X0011:Ush2a UTSW 1 188,051,166 (GRCm39) missense probably benign 0.00
X0024:Ush2a UTSW 1 188,132,479 (GRCm39) missense probably damaging 1.00
X0026:Ush2a UTSW 1 188,051,222 (GRCm39) missense possibly damaging 0.94
X0062:Ush2a UTSW 1 188,282,051 (GRCm39) missense probably damaging 1.00
Y4340:Ush2a UTSW 1 188,475,826 (GRCm39) missense possibly damaging 0.87
Y4341:Ush2a UTSW 1 188,475,826 (GRCm39) missense possibly damaging 0.87
Z1088:Ush2a UTSW 1 188,679,201 (GRCm39) missense probably benign 0.26
Z1088:Ush2a UTSW 1 188,644,180 (GRCm39) missense probably benign
Z1176:Ush2a UTSW 1 188,089,038 (GRCm39) missense probably damaging 1.00
Z1177:Ush2a UTSW 1 188,644,407 (GRCm39) missense possibly damaging 0.77
Z1177:Ush2a UTSW 1 188,465,741 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGTGACTACCATCTCCACATC -3'
(R):5'- CATTTGACTGCATGGGCTCTTC -3'

Sequencing Primer
(F):5'- TTCTATAACTCCAGGTCCAGGGG -3'
(R):5'- GGCTCTTCCCACTGTAAGAAAATAAC -3'
Posted On 2016-07-22