Incidental Mutation 'R0009:Glud1'
ID 40495
Institutional Source Beutler Lab
Gene Symbol Glud1
Ensembl Gene ENSMUSG00000021794
Gene Name glutamate dehydrogenase 1
Synonyms Gdh-X, Glud
MMRRC Submission 038304-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.939) question?
Stock # R0009 (G1)
Quality Score 183
Status Validated
Chromosome 14
Chromosomal Location 34310727-34345265 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 34334268 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 300 (G300S)
Ref Sequence ENSEMBL: ENSMUSP00000022322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022322]
AlphaFold P26443
Predicted Effect probably benign
Transcript: ENSMUST00000022322
AA Change: G300S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022322
Gene: ENSMUSG00000021794
AA Change: G300S

DomainStartEndE-ValueType
low complexity region 8 33 N/A INTRINSIC
Pfam:ELFV_dehydrog_N 112 242 1.3e-63 PFAM
ELFV_dehydrog 265 554 1.33e-88 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162912
Predicted Effect unknown
Transcript: ENSMUST00000163955
AA Change: G1S
SMART Domains Protein: ENSMUSP00000130934
Gene: ENSMUSG00000021794
AA Change: G1S

DomainStartEndE-ValueType
ELFV_dehydrog 2 139 5.91e-31 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes glutamate dehydrogenase, which is a mitochondrial matrix enzyme that catalyzes the oxidative deamination of glutamate to alpha-ketoglutarate and ammonia. This enzyme has an important role in regulating amino acid-induced insulin secretion. It is allosterically activated by ADP and inhibited by GTP and ATP. Activating mutations in this gene are a common cause of congenital hyperinsulinism. Alternative splicing of this gene results in multiple transcript variants. The related glutamate dehydrogenase 2 gene on the human X-chromosome originated from this gene via retrotransposition and encodes a soluble form of glutamate dehydrogenase. Related pseudogenes have been identified on chromosomes 10, 18 and X. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a conditionally allele activated in beta cells exhibit reduced glucose-stimulated insulin secretion and disorganization of pancreatic islets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T G 15: 60,919,633 probably benign Het
Abcg4 T G 9: 44,277,649 probably benign Het
Afm C A 5: 90,545,384 probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Aplnr T A 2: 85,137,276 probably null Het
Arih2 T A 9: 108,611,727 H264L probably damaging Het
Atp1a1 A T 3: 101,579,835 I886N possibly damaging Het
Bmf A T 2: 118,549,622 V14E probably damaging Het
Ccdc116 T C 16: 17,144,039 E15G probably damaging Het
Ccdc175 T C 12: 72,135,965 N427D possibly damaging Het
Cfap53 A G 18: 74,299,176 H45R probably benign Het
Chd3 A G 11: 69,349,906 L1569P probably damaging Het
Cntn2 G A 1: 132,516,180 Q457* probably null Het
Coro1a A T 7: 126,701,413 probably benign Het
Cracr2b T A 7: 141,463,759 L91Q probably damaging Het
Ctdspl T C 9: 119,020,046 probably null Het
Dip2b T A 15: 100,169,312 L565Q probably damaging Het
Dip2c T A 13: 9,621,903 C1004S probably damaging Het
Dnah11 A T 12: 118,045,522 I2135N possibly damaging Het
Dnah14 A G 1: 181,769,407 probably benign Het
Dnase1 T C 16: 4,038,946 V147A probably damaging Het
Dusp8 T C 7: 142,082,054 probably benign Het
Fer1l6 T C 15: 58,662,787 Y1828H probably damaging Het
Flvcr1 A G 1: 191,008,191 V544A probably benign Het
Fsd1l T C 4: 53,687,209 V311A probably benign Het
Gm4847 C T 1: 166,630,486 V433I probably benign Het
Gstm3 T G 3: 107,967,840 Y62S probably damaging Het
Gtse1 C T 15: 85,862,435 P151S probably benign Het
Herc2 T C 7: 56,207,812 S4048P probably benign Het
Hp1bp3 T A 4: 138,221,683 I19K probably benign Het
Htr7 C A 19: 36,041,540 probably benign Het
Il1a C T 2: 129,309,074 D10N probably damaging Het
Il22ra2 A T 10: 19,624,458 N39I probably damaging Het
Kcnn4 T C 7: 24,379,255 C267R possibly damaging Het
Larp1 A G 11: 58,055,473 K879R possibly damaging Het
Lcn5 T A 2: 25,661,405 probably benign Het
Lep T A 6: 29,068,972 C7* probably null Het
Magi2 A T 5: 20,611,055 Y747F probably benign Het
Mast4 T C 13: 102,742,058 T1223A probably damaging Het
Mcc C T 18: 44,445,933 E803K probably damaging Het
Mtmr4 T C 11: 87,611,508 I796T probably benign Het
Myef2 A T 2: 125,108,978 D312E probably benign Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Myo19 T A 11: 84,888,169 probably null Het
Naa15 T G 3: 51,470,219 H763Q probably damaging Het
Pde5a C T 3: 122,824,902 probably benign Het
Plpp2 C T 10: 79,527,244 R184H probably benign Het
Rab19 T G 6: 39,389,687 L179V probably damaging Het
Rims2 T A 15: 39,534,966 M1087K probably damaging Het
Riox2 C A 16: 59,489,367 D361E probably benign Het
Sh3rf1 T A 8: 61,226,293 V123E probably damaging Het
Slc35e1 A T 8: 72,484,709 N318K probably damaging Het
Slc9a2 A T 1: 40,763,602 E604V probably benign Het
Srp72 T C 5: 76,987,885 S221P probably damaging Het
Tbx19 A T 1: 165,160,520 S15T possibly damaging Het
Tcea2 A G 2: 181,685,817 T112A probably benign Het
Tesk1 T A 4: 43,445,368 D230E probably damaging Het
Tm4sf5 C T 11: 70,510,712 A179V probably damaging Het
Tnr G T 1: 159,852,416 G320V probably damaging Het
Trappc11 A T 8: 47,503,320 C874S possibly damaging Het
Trpm3 T A 19: 22,914,446 Y885N probably damaging Het
Unc5a T A 13: 55,002,879 C505S probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Xpo5 T C 17: 46,204,786 probably benign Het
Zfp637 C A 6: 117,845,668 H252Q probably damaging Het
Zfp646 T A 7: 127,880,731 D693E probably damaging Het
Other mutations in Glud1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Glud1 APN 14 34336130 missense probably benign
IGL00973:Glud1 APN 14 34319942 missense probably damaging 1.00
IGL01896:Glud1 APN 14 34319905 missense probably benign 0.00
IGL02442:Glud1 APN 14 34335438 nonsense probably null
IGL03242:Glud1 APN 14 34334280 missense probably benign 0.00
PIT4283001:Glud1 UTSW 14 34336172 missense probably damaging 0.97
R0009:Glud1 UTSW 14 34334268 missense probably benign
R0845:Glud1 UTSW 14 34329394 unclassified probably benign
R1765:Glud1 UTSW 14 34325584 splice site probably benign
R3870:Glud1 UTSW 14 34325580 splice site probably benign
R4645:Glud1 UTSW 14 34311106 missense probably damaging 1.00
R4773:Glud1 UTSW 14 34321825 critical splice donor site probably null
R4883:Glud1 UTSW 14 34335390 missense possibly damaging 0.56
R5912:Glud1 UTSW 14 34311343 critical splice donor site probably null
R6356:Glud1 UTSW 14 34311216 missense probably benign
R6443:Glud1 UTSW 14 34339927 missense probably benign 0.02
R7658:Glud1 UTSW 14 34311157 missense probably benign 0.25
R7806:Glud1 UTSW 14 34343649 missense probably damaging 1.00
R7817:Glud1 UTSW 14 34329287 critical splice acceptor site probably null
R7862:Glud1 UTSW 14 34325522 missense possibly damaging 0.74
R8178:Glud1 UTSW 14 34343707 missense probably damaging 1.00
R8398:Glud1 UTSW 14 34311271 missense probably benign 0.06
R9130:Glud1 UTSW 14 34335392 missense
R9523:Glud1 UTSW 14 34339974 missense probably benign
R9765:Glud1 UTSW 14 34338838 nonsense probably null
X0013:Glud1 UTSW 14 34338823 missense probably damaging 1.00
Z1177:Glud1 UTSW 14 34310869 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCAGAAGAGACCTCAGTCCTTCCTTTA -3'
(R):5'- CCAAAAGAAGTTGGTGACAGTCACGTT -3'

Sequencing Primer
(F):5'- tcaggaaaacgagcactctac -3'
(R):5'- gtgagacggacgagcag -3'
Posted On 2013-05-23