Incidental Mutation 'R5323:Shprh'
ID404972
Institutional Source Beutler Lab
Gene Symbol Shprh
Ensembl Gene ENSMUSG00000090112
Gene NameSNF2 histone linker PHD RING helicase
Synonyms2610103K11Rik, D230017O13Rik
MMRRC Submission 042906-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5323 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location11149427-11217595 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 11170297 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000054814] [ENSMUST00000159541] [ENSMUST00000159541] [ENSMUST00000159810] [ENSMUST00000160461]
Predicted Effect probably null
Transcript: ENSMUST00000044053
SMART Domains Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
Pfam:Helicase_C 1500 1613 1.6e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000054814
SMART Domains Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1616 6e-8 SMART
Blast:HELICc 1533 1613 4e-46 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000054814
SMART Domains Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1616 6e-8 SMART
Blast:HELICc 1533 1613 4e-46 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000159541
SMART Domains Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1619 4e-8 SMART
Blast:HELICc 1533 1613 6e-46 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000159541
SMART Domains Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1619 4e-8 SMART
Blast:HELICc 1533 1613 6e-46 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159553
Predicted Effect silent
Transcript: ENSMUST00000159810
SMART Domains Protein: ENSMUSP00000125457
Gene: ENSMUSG00000090112

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 2e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
Blast:DEXDc 948 1026 2e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160461
SMART Domains Protein: ENSMUSP00000125127
Gene: ENSMUSG00000090112

DomainStartEndE-ValueType
PHD 131 178 2.33e-5 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T A 7: 82,557,061 C784S probably damaging Het
Ahnak2 A T 12: 112,779,812 probably benign Het
Apon A G 10: 128,255,038 E195G probably damaging Het
Atxn10 A G 15: 85,391,743 I334V probably benign Het
Camsap1 G T 2: 25,965,811 A145E probably damaging Het
Capns1 G T 7: 30,187,722 F243L possibly damaging Het
Catsper2 A T 2: 121,406,735 I228N probably damaging Het
Ceacam14 A T 7: 17,815,477 *264C probably null Het
Cel A C 2: 28,560,518 V165G probably damaging Het
Cldnd1 T A 16: 58,729,653 D66E possibly damaging Het
Cntnap5b T A 1: 100,383,550 C589* probably null Het
Dnah3 T A 7: 120,021,011 H1554L probably damaging Het
Fbxw25 T A 9: 109,663,505 M55L probably benign Het
Fn1 T C 1: 71,597,432 H2187R probably benign Het
Fsip2 A G 2: 82,988,145 T4741A possibly damaging Het
Gabpa T A 16: 84,857,046 I272N possibly damaging Het
Ganab T C 19: 8,908,685 S212P probably benign Het
Ggt1 A G 10: 75,585,661 probably null Het
Hpgds T C 6: 65,132,185 T81A probably benign Het
Insr G A 8: 3,202,902 T419I probably benign Het
Itgb7 A G 15: 102,231,624 probably benign Het
Kcnt1 A G 2: 25,909,277 I951V possibly damaging Het
Lrrc4c T A 2: 97,630,153 C375S probably damaging Het
Muc3 G T 5: 137,146,689 C44* probably null Het
Mycbpap A T 11: 94,503,504 D313E probably benign Het
Neo1 A G 9: 58,906,648 probably null Het
Ntsr2 C T 12: 16,659,933 S405F probably benign Het
Nup153 G A 13: 46,717,206 P21S probably benign Het
Obscn T A 11: 58,996,877 E7705D probably benign Het
Ogn A G 13: 49,609,341 D53G probably benign Het
Olfr116 A T 17: 37,624,155 I160K probably benign Het
Olfr1505 A T 19: 13,919,616 I199F possibly damaging Het
Olfr175-ps1 G A 16: 58,824,703 T2I probably benign Het
Olfr467 T C 7: 107,814,676 F33L possibly damaging Het
Olfr976 A T 9: 39,956,829 Y35* probably null Het
Pde6a G A 18: 61,232,911 R236H possibly damaging Het
Pigk T A 3: 152,738,200 M85K probably damaging Het
Pirb A C 7: 3,716,599 I516S possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Pum2 T A 12: 8,744,706 I737N probably damaging Het
Recql5 A T 11: 115,927,389 C159S probably damaging Het
Rxrg A G 1: 167,625,004 N125S probably benign Het
Sgip1 C A 4: 102,966,280 N699K probably damaging Het
Smcp C T 3: 92,584,147 G131D unknown Het
St8sia6 A G 2: 13,793,377 L23P possibly damaging Het
Stk32c T A 7: 139,119,360 T335S probably benign Het
Stox1 G A 10: 62,664,033 A916V possibly damaging Het
Syk A T 13: 52,631,717 T297S probably benign Het
Tert G T 13: 73,648,371 A1074S probably benign Het
Tex9 A T 9: 72,477,905 D135E probably damaging Het
Tmem132a G A 19: 10,864,007 H318Y possibly damaging Het
Ttn A G 2: 76,907,905 S4097P probably benign Het
Ush2a A T 1: 188,821,677 probably null Het
Usp36 A T 11: 118,265,194 S586T probably benign Het
Vsig8 A G 1: 172,560,677 S71G probably benign Het
Zfp318 G A 17: 46,386,736 D173N probably damaging Het
Zfp638 T A 6: 83,962,094 S936T probably damaging Het
Zic2 A G 14: 122,476,316 Y214C probably damaging Het
Other mutations in Shprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Shprh APN 10 11188158 missense probably damaging 1.00
IGL00583:Shprh APN 10 11188020 missense probably benign 0.37
IGL00684:Shprh APN 10 11163037 missense probably benign 0.11
IGL01295:Shprh APN 10 11183868 missense probably damaging 0.96
IGL01387:Shprh APN 10 11170254 missense probably damaging 1.00
IGL01635:Shprh APN 10 11170019 nonsense probably null
IGL01833:Shprh APN 10 11191062 missense probably damaging 1.00
IGL02013:Shprh APN 10 11181502 splice site probably benign
IGL02502:Shprh APN 10 11194357 missense possibly damaging 0.66
IGL02819:Shprh APN 10 11154765 missense possibly damaging 0.93
PIT4581001:Shprh UTSW 10 11192494 frame shift probably null
R0010:Shprh UTSW 10 11151931 missense probably benign
R0010:Shprh UTSW 10 11151931 missense probably benign
R0053:Shprh UTSW 10 11194372 splice site probably null
R0053:Shprh UTSW 10 11194372 splice site probably null
R0255:Shprh UTSW 10 11186391 missense possibly damaging 0.92
R0325:Shprh UTSW 10 11170109 missense probably benign 0.00
R0331:Shprh UTSW 10 11194170 splice site probably benign
R0494:Shprh UTSW 10 11157191 missense probably damaging 1.00
R0532:Shprh UTSW 10 11162812 missense possibly damaging 0.90
R0546:Shprh UTSW 10 11183887 splice site probably benign
R0574:Shprh UTSW 10 11163077 unclassified probably benign
R0605:Shprh UTSW 10 11207112 missense probably damaging 1.00
R0662:Shprh UTSW 10 11186847 missense probably damaging 1.00
R1148:Shprh UTSW 10 11213482 missense possibly damaging 0.95
R1148:Shprh UTSW 10 11213482 missense possibly damaging 0.95
R1263:Shprh UTSW 10 11159530 missense probably damaging 1.00
R1588:Shprh UTSW 10 11164744 missense probably damaging 1.00
R1638:Shprh UTSW 10 11157078 missense probably benign
R1830:Shprh UTSW 10 11186911 splice site probably null
R1898:Shprh UTSW 10 11186869 missense probably damaging 1.00
R1903:Shprh UTSW 10 11183797 nonsense probably null
R2060:Shprh UTSW 10 11152120 missense probably benign 0.03
R2225:Shprh UTSW 10 11162235 unclassified probably benign
R2363:Shprh UTSW 10 11171953 missense probably damaging 1.00
R2509:Shprh UTSW 10 11166724 missense probably damaging 1.00
R2891:Shprh UTSW 10 11164356 missense probably damaging 1.00
R3077:Shprh UTSW 10 11170413 missense probably damaging 1.00
R3150:Shprh UTSW 10 11170030 missense probably damaging 0.97
R3796:Shprh UTSW 10 11178757 missense possibly damaging 0.89
R4196:Shprh UTSW 10 11207860 utr 3 prime probably benign
R4423:Shprh UTSW 10 11186518 missense possibly damaging 0.82
R4488:Shprh UTSW 10 11160471 missense probably benign 0.17
R4748:Shprh UTSW 10 11170476 missense probably damaging 1.00
R4768:Shprh UTSW 10 11181540 missense probably damaging 0.96
R4867:Shprh UTSW 10 11164557 missense probably benign 0.00
R4937:Shprh UTSW 10 11157119 missense probably benign
R5140:Shprh UTSW 10 11154705 missense probably benign 0.03
R5318:Shprh UTSW 10 11166557 missense probably benign 0.04
R5450:Shprh UTSW 10 11212330 missense possibly damaging 0.70
R5872:Shprh UTSW 10 11188073 missense probably damaging 1.00
R6030:Shprh UTSW 10 11151991 missense probably benign 0.37
R6030:Shprh UTSW 10 11151991 missense probably benign 0.37
R6392:Shprh UTSW 10 11178741 nonsense probably null
R6416:Shprh UTSW 10 11167873 missense probably damaging 1.00
R6470:Shprh UTSW 10 11171937 missense probably damaging 0.98
R6513:Shprh UTSW 10 11186893 missense probably damaging 1.00
R6530:Shprh UTSW 10 11194267 missense probably benign 0.02
R6678:Shprh UTSW 10 11166545 missense probably benign 0.16
R6757:Shprh UTSW 10 11181508 splice site probably null
R6971:Shprh UTSW 10 11166693 missense probably damaging 1.00
R7158:Shprh UTSW 10 11166730 missense probably damaging 0.98
R7582:Shprh UTSW 10 11164705 missense probably benign
R7757:Shprh UTSW 10 11162180 missense probably benign 0.30
R7812:Shprh UTSW 10 11151991 missense probably benign
R7998:Shprh UTSW 10 11185341 missense probably damaging 1.00
R8061:Shprh UTSW 10 11212333 missense possibly damaging 0.71
R8082:Shprh UTSW 10 11151811 missense probably benign 0.22
R8116:Shprh UTSW 10 11213461 missense probably damaging 0.99
R8390:Shprh UTSW 10 11187983 missense possibly damaging 0.92
R8445:Shprh UTSW 10 11181569 missense possibly damaging 0.92
R8530:Shprh UTSW 10 11151934 missense probably benign 0.37
R8759:Shprh UTSW 10 11157164 missense possibly damaging 0.92
R8937:Shprh UTSW 10 11185437 missense possibly damaging 0.60
RF012:Shprh UTSW 10 11164841 missense probably benign 0.02
V8831:Shprh UTSW 10 11186862 missense probably damaging 1.00
Z1176:Shprh UTSW 10 11164553 missense probably benign
Z1176:Shprh UTSW 10 11186447 missense probably damaging 1.00
Z1177:Shprh UTSW 10 11151762 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGCCAAGATAATGTGGAGGTC -3'
(R):5'- TGGAGTGGCAAGAATTCCCC -3'

Sequencing Primer
(F):5'- GTCTGCAAAGAAAGATGTCATTGACC -3'
(R):5'- CACGAACAGCCTGTGGATG -3'
Posted On2016-07-22