Incidental Mutation 'R5323:Recql5'
ID404979
Institutional Source Beutler Lab
Gene Symbol Recql5
Ensembl Gene ENSMUSG00000020752
Gene NameRecQ protein-like 5
SynonymsRecq5b, Recql5b
MMRRC Submission 042906-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #R5323 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location115892595-115933477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115927389 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 159 (C159S)
Ref Sequence ENSEMBL: ENSMUSP00000137157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021097] [ENSMUST00000131578] [ENSMUST00000134208] [ENSMUST00000140174]
Predicted Effect probably damaging
Transcript: ENSMUST00000021097
AA Change: C273S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021097
Gene: ENSMUSG00000020752
AA Change: C273S

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
HELICc 274 355 8.68e-22 SMART
Pfam:RecQ_Zn_bind 366 436 1.8e-12 PFAM
low complexity region 472 499 N/A INTRINSIC
PDB:4BK0|B 516 621 2e-51 PDB
Pfam:RecQ5 626 818 3.1e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131578
SMART Domains Protein: ENSMUSP00000136178
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
HELICc 1 82 8.68e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000134208
AA Change: C159S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137157
Gene: ENSMUSG00000020752
AA Change: C159S

DomainStartEndE-ValueType
Blast:DEXDc 25 96 4e-34 BLAST
HELICc 160 241 8.68e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134391
Predicted Effect probably benign
Transcript: ENSMUST00000140174
SMART Domains Protein: ENSMUSP00000136506
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156776
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a helicase that is important for genome stability. The encoded protein also prevents aberrant homologous recombination by displacing RAD51 from ssDNA. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene express elevated levels of sister chromatid exchange due to a failure to suppress crossovers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T A 7: 82,557,061 C784S probably damaging Het
Ahnak2 A T 12: 112,779,812 probably benign Het
Apon A G 10: 128,255,038 E195G probably damaging Het
Atxn10 A G 15: 85,391,743 I334V probably benign Het
Camsap1 G T 2: 25,965,811 A145E probably damaging Het
Capns1 G T 7: 30,187,722 F243L possibly damaging Het
Catsper2 A T 2: 121,406,735 I228N probably damaging Het
Ceacam14 A T 7: 17,815,477 *264C probably null Het
Cel A C 2: 28,560,518 V165G probably damaging Het
Cldnd1 T A 16: 58,729,653 D66E possibly damaging Het
Cntnap5b T A 1: 100,383,550 C589* probably null Het
Dnah3 T A 7: 120,021,011 H1554L probably damaging Het
Fbxw25 T A 9: 109,663,505 M55L probably benign Het
Fn1 T C 1: 71,597,432 H2187R probably benign Het
Fsip2 A G 2: 82,988,145 T4741A possibly damaging Het
Gabpa T A 16: 84,857,046 I272N possibly damaging Het
Ganab T C 19: 8,908,685 S212P probably benign Het
Ggt1 A G 10: 75,585,661 probably null Het
Hpgds T C 6: 65,132,185 T81A probably benign Het
Insr G A 8: 3,202,902 T419I probably benign Het
Itgb7 A G 15: 102,231,624 probably benign Het
Kcnt1 A G 2: 25,909,277 I951V possibly damaging Het
Lrrc4c T A 2: 97,630,153 C375S probably damaging Het
Muc3 G T 5: 137,146,689 C44* probably null Het
Mycbpap A T 11: 94,503,504 D313E probably benign Het
Neo1 A G 9: 58,906,648 probably null Het
Ntsr2 C T 12: 16,659,933 S405F probably benign Het
Nup153 G A 13: 46,717,206 P21S probably benign Het
Obscn T A 11: 58,996,877 E7705D probably benign Het
Ogn A G 13: 49,609,341 D53G probably benign Het
Olfr116 A T 17: 37,624,155 I160K probably benign Het
Olfr1505 A T 19: 13,919,616 I199F possibly damaging Het
Olfr175-ps1 G A 16: 58,824,703 T2I probably benign Het
Olfr467 T C 7: 107,814,676 F33L possibly damaging Het
Olfr976 A T 9: 39,956,829 Y35* probably null Het
Pde6a G A 18: 61,232,911 R236H possibly damaging Het
Pigk T A 3: 152,738,200 M85K probably damaging Het
Pirb A C 7: 3,716,599 I516S possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Pum2 T A 12: 8,744,706 I737N probably damaging Het
Rxrg A G 1: 167,625,004 N125S probably benign Het
Sgip1 C A 4: 102,966,280 N699K probably damaging Het
Shprh G A 10: 11,170,297 probably null Het
Smcp C T 3: 92,584,147 G131D unknown Het
St8sia6 A G 2: 13,793,377 L23P possibly damaging Het
Stk32c T A 7: 139,119,360 T335S probably benign Het
Stox1 G A 10: 62,664,033 A916V possibly damaging Het
Syk A T 13: 52,631,717 T297S probably benign Het
Tert G T 13: 73,648,371 A1074S probably benign Het
Tex9 A T 9: 72,477,905 D135E probably damaging Het
Tmem132a G A 19: 10,864,007 H318Y possibly damaging Het
Ttn A G 2: 76,907,905 S4097P probably benign Het
Ush2a A T 1: 188,821,677 probably null Het
Usp36 A T 11: 118,265,194 S586T probably benign Het
Vsig8 A G 1: 172,560,677 S71G probably benign Het
Zfp318 G A 17: 46,386,736 D173N probably damaging Het
Zfp638 T A 6: 83,962,094 S936T probably damaging Het
Zic2 A G 14: 122,476,316 Y214C probably damaging Het
Other mutations in Recql5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Recql5 APN 11 115897181 missense probably benign 0.04
IGL01589:Recql5 APN 11 115894669 missense probably damaging 1.00
IGL02040:Recql5 APN 11 115932797 missense possibly damaging 0.89
IGL02131:Recql5 APN 11 115923242 missense probably benign 0.01
IGL02198:Recql5 APN 11 115894673 missense probably benign 0.00
IGL02236:Recql5 APN 11 115894030 missense probably benign 0.01
IGL02501:Recql5 APN 11 115895091 missense probably benign 0.26
IGL02980:Recql5 APN 11 115893944 splice site probably null
IGL03028:Recql5 APN 11 115894431 missense possibly damaging 0.94
PIT4581001:Recql5 UTSW 11 115932856 missense possibly damaging 0.53
R0152:Recql5 UTSW 11 115894673 missense probably benign
R0269:Recql5 UTSW 11 115928224 missense possibly damaging 0.91
R0317:Recql5 UTSW 11 115894673 missense probably benign
R0511:Recql5 UTSW 11 115928383 missense probably benign 0.00
R0786:Recql5 UTSW 11 115895802 missense probably benign
R0975:Recql5 UTSW 11 115923256 missense probably damaging 1.00
R1170:Recql5 UTSW 11 115897234 missense probably damaging 0.98
R1208:Recql5 UTSW 11 115893156 missense probably damaging 0.98
R1208:Recql5 UTSW 11 115893156 missense probably damaging 0.98
R1807:Recql5 UTSW 11 115895115 missense possibly damaging 0.63
R1872:Recql5 UTSW 11 115923309 missense probably benign 0.15
R1878:Recql5 UTSW 11 115895101 missense probably benign 0.00
R1935:Recql5 UTSW 11 115897191 missense probably benign 0.00
R1936:Recql5 UTSW 11 115897191 missense probably benign 0.00
R1945:Recql5 UTSW 11 115928297 nonsense probably null
R2011:Recql5 UTSW 11 115897097 missense probably benign 0.20
R2012:Recql5 UTSW 11 115897097 missense probably benign 0.20
R2023:Recql5 UTSW 11 115893640 missense probably benign
R2183:Recql5 UTSW 11 115896787 missense probably benign 0.00
R3881:Recql5 UTSW 11 115893954 missense probably benign
R3881:Recql5 UTSW 11 115893955 missense probably benign 0.00
R4093:Recql5 UTSW 11 115904888 missense probably benign 0.05
R4857:Recql5 UTSW 11 115928212 missense probably damaging 1.00
R5245:Recql5 UTSW 11 115893559 missense probably damaging 1.00
R5796:Recql5 UTSW 11 115927865 intron probably benign
R6160:Recql5 UTSW 11 115932787 critical splice donor site probably null
R6229:Recql5 UTSW 11 115930714 missense probably damaging 0.96
R6824:Recql5 UTSW 11 115923212 missense possibly damaging 0.83
R7013:Recql5 UTSW 11 115894576 missense probably benign 0.02
R7043:Recql5 UTSW 11 115930676 critical splice donor site probably null
R7135:Recql5 UTSW 11 115930672 splice site probably null
R7354:Recql5 UTSW 11 115928201 missense probably damaging 1.00
R7373:Recql5 UTSW 11 115928372 missense possibly damaging 0.92
R7503:Recql5 UTSW 11 115895055 missense probably benign 0.00
R7574:Recql5 UTSW 11 115928422 missense probably benign
R7597:Recql5 UTSW 11 115928381 missense probably benign 0.03
R7658:Recql5 UTSW 11 115923276 missense probably damaging 1.00
X0026:Recql5 UTSW 11 115923261 missense probably damaging 1.00
X0028:Recql5 UTSW 11 115894606 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTCAGAGTCACCGGTTTCTAG -3'
(R):5'- AAGTGATGAGCCCTGTTGG -3'

Sequencing Primer
(F):5'- GGGATTGAGTAAATCACTTTAGCTC -3'
(R):5'- GCTGTCCCGCCTCAGAGAAG -3'
Posted On2016-07-22