Incidental Mutation 'R5323:Polr3a'
ID404988
Institutional Source Beutler Lab
Gene Symbol Polr3a
Ensembl Gene ENSMUSG00000025280
Gene Namepolymerase (RNA) III (DNA directed) polypeptide A
SynonymsRPC1, 9330175N20Rik, RPC155
MMRRC Submission 042906-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5323 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location24448696-24487058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24454941 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1084 (I1084V)
Ref Sequence ENSEMBL: ENSMUSP00000026322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026322
AA Change: I1084V

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280
AA Change: I1084V

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223848
Meta Mutation Damage Score 0.1175 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T A 7: 82,557,061 C784S probably damaging Het
Ahnak2 A T 12: 112,779,812 probably benign Het
Apon A G 10: 128,255,038 E195G probably damaging Het
Atxn10 A G 15: 85,391,743 I334V probably benign Het
Camsap1 G T 2: 25,965,811 A145E probably damaging Het
Capns1 G T 7: 30,187,722 F243L possibly damaging Het
Catsper2 A T 2: 121,406,735 I228N probably damaging Het
Ceacam14 A T 7: 17,815,477 *264C probably null Het
Cel A C 2: 28,560,518 V165G probably damaging Het
Cldnd1 T A 16: 58,729,653 D66E possibly damaging Het
Cntnap5b T A 1: 100,383,550 C589* probably null Het
Dnah3 T A 7: 120,021,011 H1554L probably damaging Het
Fbxw25 T A 9: 109,663,505 M55L probably benign Het
Fn1 T C 1: 71,597,432 H2187R probably benign Het
Fsip2 A G 2: 82,988,145 T4741A possibly damaging Het
Gabpa T A 16: 84,857,046 I272N possibly damaging Het
Ganab T C 19: 8,908,685 S212P probably benign Het
Ggt1 A G 10: 75,585,661 probably null Het
Hpgds T C 6: 65,132,185 T81A probably benign Het
Insr G A 8: 3,202,902 T419I probably benign Het
Itgb7 A G 15: 102,231,624 probably benign Het
Kcnt1 A G 2: 25,909,277 I951V possibly damaging Het
Lrrc4c T A 2: 97,630,153 C375S probably damaging Het
Muc3 G T 5: 137,146,689 C44* probably null Het
Mycbpap A T 11: 94,503,504 D313E probably benign Het
Neo1 A G 9: 58,906,648 probably null Het
Ntsr2 C T 12: 16,659,933 S405F probably benign Het
Nup153 G A 13: 46,717,206 P21S probably benign Het
Obscn T A 11: 58,996,877 E7705D probably benign Het
Ogn A G 13: 49,609,341 D53G probably benign Het
Olfr116 A T 17: 37,624,155 I160K probably benign Het
Olfr1505 A T 19: 13,919,616 I199F possibly damaging Het
Olfr175-ps1 G A 16: 58,824,703 T2I probably benign Het
Olfr467 T C 7: 107,814,676 F33L possibly damaging Het
Olfr976 A T 9: 39,956,829 Y35* probably null Het
Pde6a G A 18: 61,232,911 R236H possibly damaging Het
Pigk T A 3: 152,738,200 M85K probably damaging Het
Pirb A C 7: 3,716,599 I516S possibly damaging Het
Pum2 T A 12: 8,744,706 I737N probably damaging Het
Recql5 A T 11: 115,927,389 C159S probably damaging Het
Rxrg A G 1: 167,625,004 N125S probably benign Het
Sgip1 C A 4: 102,966,280 N699K probably damaging Het
Shprh G A 10: 11,170,297 probably null Het
Smcp C T 3: 92,584,147 G131D unknown Het
St8sia6 A G 2: 13,793,377 L23P possibly damaging Het
Stk32c T A 7: 139,119,360 T335S probably benign Het
Stox1 G A 10: 62,664,033 A916V possibly damaging Het
Syk A T 13: 52,631,717 T297S probably benign Het
Tert G T 13: 73,648,371 A1074S probably benign Het
Tex9 A T 9: 72,477,905 D135E probably damaging Het
Tmem132a G A 19: 10,864,007 H318Y possibly damaging Het
Ttn A G 2: 76,907,905 S4097P probably benign Het
Ush2a A T 1: 188,821,677 probably null Het
Usp36 A T 11: 118,265,194 S586T probably benign Het
Vsig8 A G 1: 172,560,677 S71G probably benign Het
Zfp318 G A 17: 46,386,736 D173N probably damaging Het
Zfp638 T A 6: 83,962,094 S936T probably damaging Het
Zic2 A G 14: 122,476,316 Y214C probably damaging Het
Other mutations in Polr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Polr3a APN 14 24475863 missense probably benign 0.35
IGL00974:Polr3a APN 14 24479424 missense probably benign 0.05
IGL01348:Polr3a APN 14 24461763 missense probably damaging 1.00
IGL01464:Polr3a APN 14 24470681 splice site probably benign
IGL01785:Polr3a APN 14 24484120 nonsense probably null
IGL01786:Polr3a APN 14 24484120 nonsense probably null
IGL01936:Polr3a APN 14 24479188 missense probably damaging 1.00
IGL02095:Polr3a APN 14 24454610 missense possibly damaging 0.91
IGL02454:Polr3a APN 14 24475823 missense possibly damaging 0.87
IGL02702:Polr3a APN 14 24470877 missense probably benign 0.07
IGL02961:Polr3a APN 14 24467040 nonsense probably null
IGL03069:Polr3a APN 14 24461740 missense probably damaging 0.99
R0001:Polr3a UTSW 14 24452189 splice site probably benign
R0048:Polr3a UTSW 14 24469255 splice site probably benign
R0157:Polr3a UTSW 14 24479186 missense probably damaging 0.99
R0445:Polr3a UTSW 14 24454921 missense probably benign 0.00
R0449:Polr3a UTSW 14 24484466 missense probably damaging 0.99
R0597:Polr3a UTSW 14 24484134 missense probably benign 0.29
R0604:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0644:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0703:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0754:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0767:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0816:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0817:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0819:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0840:Polr3a UTSW 14 24452200 missense possibly damaging 0.95
R1481:Polr3a UTSW 14 24452548 missense probably null 0.98
R1644:Polr3a UTSW 14 24470624 missense probably damaging 1.00
R1699:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R1704:Polr3a UTSW 14 24484120 nonsense probably null
R2363:Polr3a UTSW 14 24475892 splice site probably null
R3419:Polr3a UTSW 14 24467035 missense probably damaging 1.00
R3934:Polr3a UTSW 14 24476101 missense probably benign 0.30
R4296:Polr3a UTSW 14 24453196 missense possibly damaging 0.82
R4611:Polr3a UTSW 14 24452508 splice site probably null
R4690:Polr3a UTSW 14 24464281 missense possibly damaging 0.78
R4934:Polr3a UTSW 14 24452624 missense probably benign 0.11
R4947:Polr3a UTSW 14 24482464 missense probably benign 0.00
R5232:Polr3a UTSW 14 24453211 missense probably benign 0.00
R5263:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5264:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5265:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5282:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5319:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5321:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5387:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5388:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5401:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5402:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5443:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5444:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5725:Polr3a UTSW 14 24465387 splice site probably null
R5841:Polr3a UTSW 14 24450698 missense probably benign 0.00
R6408:Polr3a UTSW 14 24486871 critical splice donor site probably null
R6704:Polr3a UTSW 14 24461842 missense probably damaging 1.00
R7136:Polr3a UTSW 14 24461815 missense probably damaging 1.00
R7307:Polr3a UTSW 14 24459987 missense probably benign 0.03
R7368:Polr3a UTSW 14 24467076 missense probably damaging 0.98
R7800:Polr3a UTSW 14 24484387 missense probably null 0.83
Z1088:Polr3a UTSW 14 24479724 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTTCATTACCCGCACTGTCATG -3'
(R):5'- TCTCAGTGAGAGGTCTGTGACG -3'

Sequencing Primer
(F):5'- GCTGCAGGCTACATCCACAG -3'
(R):5'- AGAGGTCTGTGACGTCCCTTG -3'
Posted On2016-07-22