Incidental Mutation 'R5323:Polr3a'
ID 404988
Institutional Source Beutler Lab
Gene Symbol Polr3a
Ensembl Gene ENSMUSG00000025280
Gene Name polymerase (RNA) III (DNA directed) polypeptide A
Synonyms RPC155, 9330175N20Rik, RPC1
MMRRC Submission 042906-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5323 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 24498764-24537126 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 24505009 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1084 (I1084V)
Ref Sequence ENSEMBL: ENSMUSP00000026322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]
AlphaFold B2RXC6
Predicted Effect possibly damaging
Transcript: ENSMUST00000026322
AA Change: I1084V

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280
AA Change: I1084V

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223848
Meta Mutation Damage Score 0.1175 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T A 7: 82,206,269 (GRCm39) C784S probably damaging Het
Ahnak2 A T 12: 112,745,989 (GRCm39) probably benign Het
Apon A G 10: 128,090,907 (GRCm39) E195G probably damaging Het
Atxn10 A G 15: 85,275,944 (GRCm39) I334V probably benign Het
Camsap1 G T 2: 25,855,823 (GRCm39) A145E probably damaging Het
Capns1 G T 7: 29,887,147 (GRCm39) F243L possibly damaging Het
Catsper2 A T 2: 121,237,216 (GRCm39) I228N probably damaging Het
Ceacam14 A T 7: 17,549,402 (GRCm39) *264C probably null Het
Cel A C 2: 28,450,530 (GRCm39) V165G probably damaging Het
Cldnd1 T A 16: 58,550,016 (GRCm39) D66E possibly damaging Het
Cntnap5b T A 1: 100,311,275 (GRCm39) C589* probably null Het
Dnah3 T A 7: 119,620,234 (GRCm39) H1554L probably damaging Het
Fbxw25 T A 9: 109,492,573 (GRCm39) M55L probably benign Het
Fn1 T C 1: 71,636,591 (GRCm39) H2187R probably benign Het
Fsip2 A G 2: 82,818,489 (GRCm39) T4741A possibly damaging Het
Gabpa T A 16: 84,653,934 (GRCm39) I272N possibly damaging Het
Ganab T C 19: 8,886,049 (GRCm39) S212P probably benign Het
Ggt1 A G 10: 75,421,495 (GRCm39) probably null Het
Hpgds T C 6: 65,109,169 (GRCm39) T81A probably benign Het
Insr G A 8: 3,252,902 (GRCm39) T419I probably benign Het
Itgb7 A G 15: 102,140,059 (GRCm39) probably benign Het
Kcnt1 A G 2: 25,799,289 (GRCm39) I951V possibly damaging Het
Lrrc4c T A 2: 97,460,498 (GRCm39) C375S probably damaging Het
Muc17 G T 5: 137,175,537 (GRCm39) C44* probably null Het
Mycbpap A T 11: 94,394,330 (GRCm39) D313E probably benign Het
Neo1 A G 9: 58,813,931 (GRCm39) probably null Het
Ntsr2 C T 12: 16,709,934 (GRCm39) S405F probably benign Het
Nup153 G A 13: 46,870,682 (GRCm39) P21S probably benign Het
Obscn T A 11: 58,887,703 (GRCm39) E7705D probably benign Het
Ogn A G 13: 49,762,817 (GRCm39) D53G probably benign Het
Or10d5j A T 9: 39,868,125 (GRCm39) Y35* probably null Het
Or14j10 A T 17: 37,935,046 (GRCm39) I160K probably benign Het
Or5k8 G A 16: 58,645,066 (GRCm39) T2I probably benign Het
Or5p5 T C 7: 107,413,883 (GRCm39) F33L possibly damaging Het
Or9i1b A T 19: 13,896,980 (GRCm39) I199F possibly damaging Het
Pde6a G A 18: 61,365,983 (GRCm39) R236H possibly damaging Het
Pigk T A 3: 152,443,837 (GRCm39) M85K probably damaging Het
Pirb A C 7: 3,719,598 (GRCm39) I516S possibly damaging Het
Pum2 T A 12: 8,794,706 (GRCm39) I737N probably damaging Het
Recql5 A T 11: 115,818,215 (GRCm39) C159S probably damaging Het
Rxrg A G 1: 167,452,573 (GRCm39) N125S probably benign Het
Sgip1 C A 4: 102,823,477 (GRCm39) N699K probably damaging Het
Shprh G A 10: 11,046,041 (GRCm39) probably null Het
Smcp C T 3: 92,491,454 (GRCm39) G131D unknown Het
St8sia6 A G 2: 13,798,188 (GRCm39) L23P possibly damaging Het
Stk32c T A 7: 138,699,276 (GRCm39) T335S probably benign Het
Stox1 G A 10: 62,499,812 (GRCm39) A916V possibly damaging Het
Syk A T 13: 52,785,753 (GRCm39) T297S probably benign Het
Tert G T 13: 73,796,490 (GRCm39) A1074S probably benign Het
Tex9 A T 9: 72,385,187 (GRCm39) D135E probably damaging Het
Tmem132a G A 19: 10,841,371 (GRCm39) H318Y possibly damaging Het
Ttn A G 2: 76,738,249 (GRCm39) S4097P probably benign Het
Ush2a A T 1: 188,553,874 (GRCm39) probably null Het
Usp36 A T 11: 118,156,020 (GRCm39) S586T probably benign Het
Vsig8 A G 1: 172,388,244 (GRCm39) S71G probably benign Het
Zfp318 G A 17: 46,697,662 (GRCm39) D173N probably damaging Het
Zfp638 T A 6: 83,939,076 (GRCm39) S936T probably damaging Het
Zic2 A G 14: 122,713,728 (GRCm39) Y214C probably damaging Het
Other mutations in Polr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Polr3a APN 14 24,525,931 (GRCm39) missense probably benign 0.35
IGL00974:Polr3a APN 14 24,529,492 (GRCm39) missense probably benign 0.05
IGL01348:Polr3a APN 14 24,511,831 (GRCm39) missense probably damaging 1.00
IGL01464:Polr3a APN 14 24,520,749 (GRCm39) splice site probably benign
IGL01785:Polr3a APN 14 24,534,188 (GRCm39) nonsense probably null
IGL01786:Polr3a APN 14 24,534,188 (GRCm39) nonsense probably null
IGL01936:Polr3a APN 14 24,529,256 (GRCm39) missense probably damaging 1.00
IGL02095:Polr3a APN 14 24,504,678 (GRCm39) missense possibly damaging 0.91
IGL02454:Polr3a APN 14 24,525,891 (GRCm39) missense possibly damaging 0.87
IGL02702:Polr3a APN 14 24,520,945 (GRCm39) missense probably benign 0.07
IGL02961:Polr3a APN 14 24,517,108 (GRCm39) nonsense probably null
IGL03069:Polr3a APN 14 24,511,808 (GRCm39) missense probably damaging 0.99
R0001:Polr3a UTSW 14 24,502,257 (GRCm39) splice site probably benign
R0048:Polr3a UTSW 14 24,519,323 (GRCm39) splice site probably benign
R0157:Polr3a UTSW 14 24,529,254 (GRCm39) missense probably damaging 0.99
R0445:Polr3a UTSW 14 24,504,989 (GRCm39) missense probably benign 0.00
R0449:Polr3a UTSW 14 24,534,534 (GRCm39) missense probably damaging 0.99
R0597:Polr3a UTSW 14 24,534,202 (GRCm39) missense probably benign 0.29
R0604:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0644:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0703:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0754:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0767:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0816:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0817:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0819:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0840:Polr3a UTSW 14 24,502,268 (GRCm39) missense possibly damaging 0.95
R1481:Polr3a UTSW 14 24,502,616 (GRCm39) missense probably null 0.98
R1644:Polr3a UTSW 14 24,520,692 (GRCm39) missense probably damaging 1.00
R1699:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R1704:Polr3a UTSW 14 24,534,188 (GRCm39) nonsense probably null
R2363:Polr3a UTSW 14 24,525,960 (GRCm39) splice site probably null
R3419:Polr3a UTSW 14 24,517,103 (GRCm39) missense probably damaging 1.00
R3934:Polr3a UTSW 14 24,526,169 (GRCm39) missense probably benign 0.30
R4296:Polr3a UTSW 14 24,503,264 (GRCm39) missense possibly damaging 0.82
R4611:Polr3a UTSW 14 24,502,576 (GRCm39) splice site probably null
R4690:Polr3a UTSW 14 24,514,349 (GRCm39) missense possibly damaging 0.78
R4934:Polr3a UTSW 14 24,502,692 (GRCm39) missense probably benign 0.11
R4947:Polr3a UTSW 14 24,532,532 (GRCm39) missense probably benign 0.00
R5232:Polr3a UTSW 14 24,503,279 (GRCm39) missense probably benign 0.00
R5263:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5264:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5265:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5282:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5319:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5321:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5387:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5388:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5401:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5402:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5443:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5444:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5725:Polr3a UTSW 14 24,515,455 (GRCm39) splice site probably null
R5841:Polr3a UTSW 14 24,500,766 (GRCm39) missense probably benign 0.00
R6408:Polr3a UTSW 14 24,536,939 (GRCm39) critical splice donor site probably null
R6704:Polr3a UTSW 14 24,511,910 (GRCm39) missense probably damaging 1.00
R7136:Polr3a UTSW 14 24,511,883 (GRCm39) missense probably damaging 1.00
R7307:Polr3a UTSW 14 24,510,055 (GRCm39) missense probably benign 0.03
R7368:Polr3a UTSW 14 24,517,144 (GRCm39) missense probably damaging 0.98
R7800:Polr3a UTSW 14 24,534,455 (GRCm39) missense probably null 0.83
R8753:Polr3a UTSW 14 24,513,702 (GRCm39) nonsense probably null
R8785:Polr3a UTSW 14 24,502,383 (GRCm39) missense probably benign 0.06
R8848:Polr3a UTSW 14 24,500,834 (GRCm39) missense probably damaging 1.00
R9025:Polr3a UTSW 14 24,519,479 (GRCm39) missense probably damaging 1.00
R9139:Polr3a UTSW 14 24,519,416 (GRCm39) missense probably damaging 1.00
R9264:Polr3a UTSW 14 24,520,899 (GRCm39) missense probably benign
R9309:Polr3a UTSW 14 24,510,067 (GRCm39) missense probably benign
R9363:Polr3a UTSW 14 24,500,831 (GRCm39) missense probably damaging 1.00
R9526:Polr3a UTSW 14 24,503,313 (GRCm39) missense probably benign 0.00
R9585:Polr3a UTSW 14 24,502,289 (GRCm39) missense probably damaging 1.00
Z1088:Polr3a UTSW 14 24,529,792 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTTCATTACCCGCACTGTCATG -3'
(R):5'- TCTCAGTGAGAGGTCTGTGACG -3'

Sequencing Primer
(F):5'- GCTGCAGGCTACATCCACAG -3'
(R):5'- AGAGGTCTGTGACGTCCCTTG -3'
Posted On 2016-07-22