Mutagenetix > Incidental Mutation

Incidental Mutation 'R0009:Gtse1'

40499

Institutional Source

Beutler Lab

Gene Symbol

Gtse1

Ensembl Gene

ENSMUSG00000022385

Gene Name

G two S phase expressed protein 1

Synonyms

B99, Gtse-1

MMRRC Submission

038304-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.078) question?

Stock #

R0009 (G1)

Quality Score

168

Status

Validated

Chromosome

Chromosomal Location

85859745-85876573 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 85862435 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 151 (P151S)

Ref Sequence

ENSEMBL: ENSMUSP00000155552 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000146088] [ENSMUST00000170629] [ENSMUST00000231074]

AlphaFold

Q8R080

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133158

Predicted Effect

probably benign
Transcript: ENSMUST00000146088

SMART Domains

Protein: ENSMUSP00000114504
Gene: ENSMUSG00000035944

Domain	Start	End	E-Value	Type
SCOP:d1ld8a_	105	272	1e-7	SMART
low complexity region	342	354	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170629
AA Change: P151S

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000128759
Gene: ENSMUSG00000022385
AA Change: P151S

Domain	Start	End	E-Value	Type
Pfam:GTSE1_N	10	153	3e-62	PFAM
low complexity region	284	301	N/A	INTRINSIC
low complexity region	310	321	N/A	INTRINSIC
low complexity region	360	372	N/A	INTRINSIC
low complexity region	478	497	N/A	INTRINSIC
low complexity region	568	593	N/A	INTRINSIC
low complexity region	644	653	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000231074
AA Change: P151S

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.7%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is only expressed in the S and G2 phases of the cell cycle, where it colocalizes with cytoplasmic tubulin and microtubules. In response to DNA damage, the encoded protein accumulates in the nucleus and binds the tumor suppressor protein p53, shuttling it out of the nucleus and repressing its ability to induce apoptosis. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1bg	T	G	15: 60,919,633		probably benign	Het
Abcg4	T	G	9: 44,277,649		probably benign	Het
Afm	C	A	5: 90,545,384		probably benign	Het
Ahrr	G	A	13: 74,283,024		probably benign	Het
Aplnr	T	A	2: 85,137,276		probably null	Het
Arih2	T	A	9: 108,611,727	H264L	probably damaging	Het
Atp1a1	A	T	3: 101,579,835	I886N	possibly damaging	Het
Bmf	A	T	2: 118,549,622	V14E	probably damaging	Het
Ccdc116	T	C	16: 17,144,039	E15G	probably damaging	Het
Ccdc175	T	C	12: 72,135,965	N427D	possibly damaging	Het
Cfap53	A	G	18: 74,299,176	H45R	probably benign	Het
Chd3	A	G	11: 69,349,906	L1569P	probably damaging	Het
Cntn2	G	A	1: 132,516,180	Q457*	probably null	Het
Coro1a	A	T	7: 126,701,413		probably benign	Het
Cracr2b	T	A	7: 141,463,759	L91Q	probably damaging	Het
Ctdspl	T	C	9: 119,020,046		probably null	Het
Dip2b	T	A	15: 100,169,312	L565Q	probably damaging	Het
Dip2c	T	A	13: 9,621,903	C1004S	probably damaging	Het
Dnah11	A	T	12: 118,045,522	I2135N	possibly damaging	Het
Dnah14	A	G	1: 181,769,407		probably benign	Het
Dnase1	T	C	16: 4,038,946	V147A	probably damaging	Het
Dusp8	T	C	7: 142,082,054		probably benign	Het
Fer1l6	T	C	15: 58,662,787	Y1828H	probably damaging	Het
Flvcr1	A	G	1: 191,008,191	V544A	probably benign	Het
Fsd1l	T	C	4: 53,687,209	V311A	probably benign	Het
Glud1	G	A	14: 34,334,268	G300S	probably benign	Het
Gm4847	C	T	1: 166,630,486	V433I	probably benign	Het
Gstm3	T	G	3: 107,967,840	Y62S	probably damaging	Het
Herc2	T	C	7: 56,207,812	S4048P	probably benign	Het
Hp1bp3	T	A	4: 138,221,683	I19K	probably benign	Het
Htr7	C	A	19: 36,041,540		probably benign	Het
Il1a	C	T	2: 129,309,074	D10N	probably damaging	Het
Il22ra2	A	T	10: 19,624,458	N39I	probably damaging	Het
Kcnn4	T	C	7: 24,379,255	C267R	possibly damaging	Het
Larp1	A	G	11: 58,055,473	K879R	possibly damaging	Het
Lcn5	T	A	2: 25,661,405		probably benign	Het
Lep	T	A	6: 29,068,972	C7*	probably null	Het
Magi2	A	T	5: 20,611,055	Y747F	probably benign	Het
Mast4	T	C	13: 102,742,058	T1223A	probably damaging	Het
Mcc	C	T	18: 44,445,933	E803K	probably damaging	Het
Mtmr4	T	C	11: 87,611,508	I796T	probably benign	Het
Myef2	A	T	2: 125,108,978	D312E	probably benign	Het
Myl3	A	C	9: 110,767,929	D119A	probably damaging	Het
Myo19	T	A	11: 84,888,169		probably null	Het
Naa15	T	G	3: 51,470,219	H763Q	probably damaging	Het
Pde5a	C	T	3: 122,824,902		probably benign	Het
Plpp2	C	T	10: 79,527,244	R184H	probably benign	Het
Rab19	T	G	6: 39,389,687	L179V	probably damaging	Het
Rims2	T	A	15: 39,534,966	M1087K	probably damaging	Het
Riox2	C	A	16: 59,489,367	D361E	probably benign	Het
Sh3rf1	T	A	8: 61,226,293	V123E	probably damaging	Het
Slc35e1	A	T	8: 72,484,709	N318K	probably damaging	Het
Slc9a2	A	T	1: 40,763,602	E604V	probably benign	Het
Srp72	T	C	5: 76,987,885	S221P	probably damaging	Het
Tbx19	A	T	1: 165,160,520	S15T	possibly damaging	Het
Tcea2	A	G	2: 181,685,817	T112A	probably benign	Het
Tesk1	T	A	4: 43,445,368	D230E	probably damaging	Het
Tm4sf5	C	T	11: 70,510,712	A179V	probably damaging	Het
Tnr	G	T	1: 159,852,416	G320V	probably damaging	Het
Trappc11	A	T	8: 47,503,320	C874S	possibly damaging	Het
Trpm3	T	A	19: 22,914,446	Y885N	probably damaging	Het
Unc5a	T	A	13: 55,002,879	C505S	probably damaging	Het
Vmn1r28	G	A	6: 58,265,717	A182T	probably benign	Het
Xpo5	T	C	17: 46,204,786		probably benign	Het
Zfp637	C	A	6: 117,845,668	H252Q	probably damaging	Het
Zfp646	T	A	7: 127,880,731	D693E	probably damaging	Het

Other mutations in Gtse1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Gtse1	APN	15	85868817	missense	possibly damaging	0.54
IGL01344:Gtse1	APN	15	85862066	critical splice acceptor site	probably null
IGL01541:Gtse1	APN	15	85875654	nonsense	probably null
IGL01621:Gtse1	APN	15	85875082	missense	probably benign	0.01
IGL01945:Gtse1	APN	15	85871547	missense	probably benign	0.00
IGL02193:Gtse1	APN	15	85862330	missense	probably benign	0.27
IGL02215:Gtse1	APN	15	85862598	missense	possibly damaging	0.92
IGL02494:Gtse1	APN	15	85867503	missense	probably damaging	1.00
IGL02879:Gtse1	APN	15	85869063	splice site	probably benign
R0047:Gtse1	UTSW	15	85862378	missense	probably damaging	1.00
R0047:Gtse1	UTSW	15	85862378	missense	probably damaging	1.00
R0576:Gtse1	UTSW	15	85869051	missense	probably damaging	1.00
R1078:Gtse1	UTSW	15	85862307	missense	probably damaging	0.98
R1442:Gtse1	UTSW	15	85860102	splice site	probably benign
R1623:Gtse1	UTSW	15	85867578	missense	probably benign
R1925:Gtse1	UTSW	15	85873738	missense	probably benign	0.00
R1928:Gtse1	UTSW	15	85862063	splice site	probably benign
R4565:Gtse1	UTSW	15	85875184	missense	probably damaging	0.99
R5170:Gtse1	UTSW	15	85864264	critical splice donor site	probably null
R5310:Gtse1	UTSW	15	85873792	missense	probably benign	0.04
R5428:Gtse1	UTSW	15	85862139	missense	probably benign	0.12
R5748:Gtse1	UTSW	15	85867577	missense	probably benign
R5996:Gtse1	UTSW	15	85864180	missense	probably benign	0.00
R6179:Gtse1	UTSW	15	85868957	missense	possibly damaging	0.95
R6379:Gtse1	UTSW	15	85864224	missense	probably benign	0.01
R6381:Gtse1	UTSW	15	85862148	missense	probably benign	0.00
R6434:Gtse1	UTSW	15	85875169	missense	probably benign	0.21
R7086:Gtse1	UTSW	15	85875549	missense	probably damaging	1.00
R7304:Gtse1	UTSW	15	85871547	missense	probably benign	0.00
R7485:Gtse1	UTSW	15	85868700	missense	probably benign	0.04
R7580:Gtse1	UTSW	15	85862231	missense	probably damaging	1.00
R7856:Gtse1	UTSW	15	85864141	missense	probably benign	0.09
R8496:Gtse1	UTSW	15	85862082	missense	probably damaging	1.00
R8674:Gtse1	UTSW	15	85862175	missense	probably damaging	1.00
R8987:Gtse1	UTSW	15	85868908	missense	probably benign	0.00
R9491:Gtse1	UTSW	15	85871533	missense	probably damaging	1.00
R9642:Gtse1	UTSW	15	85867496	missense	probably damaging	0.98
Z1176:Gtse1	UTSW	15	85868746	missense	possibly damaging	0.85
Z1177:Gtse1	UTSW	15	85875737	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TTGTGGAGGTGTACAAAGAAGCCC -3'
(R):5'- AACAGCCAGAGCCCAATGTGAG -3'

Sequencing Primer
(F):5'- TGGCCTTACAGATAGAAAGTCAC -3'
(R):5'- ATCGCAACTGTACTATGCCTGG -3'

Posted On

2013-05-23