Incidental Mutation 'R5324:Serpini1'
ID 405007
Institutional Source Beutler Lab
Gene Symbol Serpini1
Ensembl Gene ENSMUSG00000027834
Gene Name serine (or cysteine) peptidase inhibitor, clade I, member 1
Synonyms PI12, Spi17, Neuroserpin, Ns
MMRRC Submission 042907-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.100) question?
Stock # R5324 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 75464800-75549830 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75547601 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 371 (I371T)
Ref Sequence ENSEMBL: ENSMUSP00000029423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029423]
AlphaFold O35684
PDB Structure Crystal Structure of Mouse Neuroserpin (Cleaved form) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000029423
AA Change: I371T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029423
Gene: ENSMUSG00000027834
AA Change: I371T

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
SERPIN 31 397 1.46e-158 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serpin superfamily of serine proteinase inhibitors. The protein is primarily secreted by axons in the brain, and preferentially reacts with and inhibits tissue-type plasminogen activator. It is thought to play a role in the regulation of axonal growth and the development of synaptic plasticity. Mutations in this gene result in familial encephalopathy with neuroserpin inclusion bodies (FENIB), which is a dominantly inherited form of familial encephalopathy and epilepsy characterized by the accumulation of mutant neuroserpin polymers. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene show no change in brain morphology or histology. However, they show an increase avoidance of novel stimuli and increased anxiety responses in some situations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap10 C T 11: 61,807,015 (GRCm39) A72T probably damaging Het
Ap5b1 G A 19: 5,619,863 (GRCm39) E428K possibly damaging Het
Bmp2 C T 2: 133,403,279 (GRCm39) R277* probably null Het
Cbl A T 9: 44,065,551 (GRCm39) S659T probably damaging Het
Col14a1 A T 15: 55,201,841 (GRCm39) H43L unknown Het
Corin A G 5: 72,592,600 (GRCm39) C133R probably damaging Het
Cyp1a1 A G 9: 57,609,652 (GRCm39) N401S probably benign Het
Dip2a T C 10: 76,132,227 (GRCm39) D508G probably damaging Het
Dnah2 T A 11: 69,348,819 (GRCm39) H2556L probably benign Het
Dock8 T C 19: 25,140,458 (GRCm39) F1333L probably benign Het
Epg5 A G 18: 78,005,660 (GRCm39) K717E possibly damaging Het
Fmn2 G A 1: 174,436,446 (GRCm39) probably benign Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Hbp1 T C 12: 31,978,617 (GRCm39) N510S probably damaging Het
Lrguk T C 6: 34,050,732 (GRCm39) S397P possibly damaging Het
Mmrn1 A T 6: 60,953,570 (GRCm39) D617V probably damaging Het
Mroh9 C G 1: 162,888,329 (GRCm39) G249R probably damaging Het
N6amt1 A G 16: 87,151,241 (GRCm39) D34G probably damaging Het
Nktr A T 9: 121,556,412 (GRCm39) D30V probably damaging Het
Or52ab7 T A 7: 102,978,257 (GRCm39) M188K probably damaging Het
Or5w8 A T 2: 87,688,040 (GRCm39) I174F probably damaging Het
Or6c212 T A 10: 129,558,814 (GRCm39) I200L probably benign Het
Pabpc1 A G 15: 36,600,869 (GRCm39) F314L probably damaging Het
Papln G A 12: 83,821,345 (GRCm39) V226M probably damaging Het
Parp12 A T 6: 39,079,546 (GRCm39) D321E probably damaging Het
Plch2 T A 4: 155,068,991 (GRCm39) T1107S probably benign Het
Psma2 T C 13: 14,799,802 (GRCm39) L182P probably damaging Het
Rcl1 A G 19: 29,105,401 (GRCm39) Y196C probably benign Het
Rdh16 G A 10: 127,637,136 (GRCm39) V24M probably damaging Het
Rpe65 A G 3: 159,310,041 (GRCm39) T105A possibly damaging Het
Tet2 T C 3: 133,191,674 (GRCm39) N920S probably benign Het
Tmem71 C T 15: 66,427,063 (GRCm39) S44N probably benign Het
Tmprss11f T A 5: 86,704,837 (GRCm39) D27V possibly damaging Het
Zfp747l1 G T 7: 126,984,079 (GRCm39) probably benign Het
Zxdc T A 6: 90,350,782 (GRCm39) I411N probably damaging Het
Other mutations in Serpini1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Serpini1 APN 3 75,548,002 (GRCm39) nonsense probably null
IGL02131:Serpini1 APN 3 75,548,011 (GRCm39) missense probably benign 0.15
IGL02265:Serpini1 APN 3 75,526,576 (GRCm39) missense probably damaging 0.96
IGL03151:Serpini1 APN 3 75,520,603 (GRCm39) missense probably benign 0.00
IGL03232:Serpini1 APN 3 75,545,317 (GRCm39) splice site probably benign
IGL03256:Serpini1 APN 3 75,526,481 (GRCm39) missense probably benign 0.04
R0021:Serpini1 UTSW 3 75,526,620 (GRCm39) missense probably damaging 1.00
R0021:Serpini1 UTSW 3 75,526,620 (GRCm39) missense probably damaging 1.00
R0449:Serpini1 UTSW 3 75,520,648 (GRCm39) missense probably benign 0.06
R0941:Serpini1 UTSW 3 75,523,934 (GRCm39) missense probably damaging 0.97
R1641:Serpini1 UTSW 3 75,521,977 (GRCm39) missense possibly damaging 0.94
R1968:Serpini1 UTSW 3 75,521,785 (GRCm39) missense probably benign 0.34
R1993:Serpini1 UTSW 3 75,521,971 (GRCm39) missense probably damaging 1.00
R2159:Serpini1 UTSW 3 75,531,251 (GRCm39) missense probably benign 0.06
R3418:Serpini1 UTSW 3 75,547,589 (GRCm39) missense probably damaging 1.00
R3419:Serpini1 UTSW 3 75,547,589 (GRCm39) missense probably damaging 1.00
R3780:Serpini1 UTSW 3 75,521,942 (GRCm39) missense probably damaging 0.96
R4618:Serpini1 UTSW 3 75,523,883 (GRCm39) missense probably benign 0.29
R4864:Serpini1 UTSW 3 75,520,481 (GRCm39) missense probably benign 0.01
R4989:Serpini1 UTSW 3 75,521,795 (GRCm39) missense probably benign 0.07
R5080:Serpini1 UTSW 3 75,523,967 (GRCm39) missense probably damaging 1.00
R5767:Serpini1 UTSW 3 75,520,388 (GRCm39) splice site probably benign
R5817:Serpini1 UTSW 3 75,520,631 (GRCm39) missense probably benign 0.07
R5912:Serpini1 UTSW 3 75,523,914 (GRCm39) missense probably benign 0.04
R5944:Serpini1 UTSW 3 75,547,606 (GRCm39) missense probably damaging 1.00
R6704:Serpini1 UTSW 3 75,545,255 (GRCm39) missense probably damaging 0.96
R7716:Serpini1 UTSW 3 75,524,021 (GRCm39) missense probably damaging 1.00
R8696:Serpini1 UTSW 3 75,520,544 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACATTTCTTCCTTAAAACCCCTG -3'
(R):5'- ATTTCCTGGAAGCAATGTTTGG -3'

Sequencing Primer
(F):5'- CTTAAAACCCCTGCTTTCTGC -3'
(R):5'- TTCCTGGAAGCAATGTTTGGAAAAG -3'
Posted On 2016-07-22