Incidental Mutation 'R0009:Dnase1'
ID 40501
Institutional Source Beutler Lab
Gene Symbol Dnase1
Ensembl Gene ENSMUSG00000005980
Gene Name deoxyribonuclease I
Synonyms Dnl1, DNaseI
MMRRC Submission 038304-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.465) question?
Stock # R0009 (G1)
Quality Score 196
Status Validated
Chromosome 16
Chromosomal Location 3855007-3857888 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3856810 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 147 (V147A)
Ref Sequence ENSEMBL: ENSMUSP00000135442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006136] [ENSMUST00000006137] [ENSMUST00000120009] [ENSMUST00000137748] [ENSMUST00000177337] [ENSMUST00000157044] [ENSMUST00000175755]
AlphaFold P49183
Predicted Effect probably damaging
Transcript: ENSMUST00000006136
AA Change: V147A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000006136
Gene: ENSMUSG00000005980
AA Change: V147A

DomainStartEndE-ValueType
DNaseIc 6 282 5.04e-220 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000006137
SMART Domains Protein: ENSMUSP00000006137
Gene: ENSMUSG00000005981

DomainStartEndE-ValueType
HATPase_c 110 263 3.68e-3 SMART
Pfam:HSP90 290 706 2.6e-98 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120009
AA Change: V147A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113119
Gene: ENSMUSG00000005980
AA Change: V147A

DomainStartEndE-ValueType
DNaseIc 6 282 5.04e-220 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132466
Predicted Effect probably damaging
Transcript: ENSMUST00000137748
AA Change: V147A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119934
Gene: ENSMUSG00000005980
AA Change: V147A

DomainStartEndE-ValueType
DNaseIc 6 225 7.51e-146 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137945
Predicted Effect probably damaging
Transcript: ENSMUST00000177337
AA Change: V147A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135442
Gene: ENSMUSG00000005980
AA Change: V147A

DomainStartEndE-ValueType
DNaseIc 6 200 6.86e-67 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139334
Predicted Effect probably benign
Transcript: ENSMUST00000157044
SMART Domains Protein: ENSMUSP00000120642
Gene: ENSMUSG00000005980

DomainStartEndE-ValueType
DNaseIc 6 70 4.5e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175755
SMART Domains Protein: ENSMUSP00000135060
Gene: ENSMUSG00000005980

DomainStartEndE-ValueType
SCOP:d2dnja_ 1 52 3e-9 SMART
Blast:DNaseIc 1 61 2e-31 BLAST
PDB:3W3D|B 1 61 5e-27 PDB
Meta Mutation Damage Score 0.1448 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNase family. This protein is stored in the zymogen granules of the nuclear envelope and functions by cleaving DNA in an endonucleolytic manner. At least six autosomal codominant alleles have been characterized, DNASE1*1 through DNASE1*6, and the sequence of DNASE1*2 represented in this record. Mutations in this gene have been associated with systemic lupus erythematosus (SLE), an autoimmune disease. A recombinant form of this protein is used to treat the one of the symptoms of cystic fibrosis by hydrolyzing the extracellular DNA in sputum and reducing its viscosity. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Some heterozygote and homozygote null mice have autoimmune symptoms similar to systemic lupus erythematosus. These include enlarged lymph nodes, circulating auto-antibodies, kidney inflammation and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T G 15: 60,791,482 (GRCm39) probably benign Het
Abcg4 T G 9: 44,188,946 (GRCm39) probably benign Het
Afm C A 5: 90,693,243 (GRCm39) probably benign Het
Ahrr G A 13: 74,431,143 (GRCm39) probably benign Het
Aplnr T A 2: 84,967,620 (GRCm39) probably null Het
Arih2 T A 9: 108,488,926 (GRCm39) H264L probably damaging Het
Atp1a1 A T 3: 101,487,151 (GRCm39) I886N possibly damaging Het
Bmf A T 2: 118,380,103 (GRCm39) V14E probably damaging Het
Ccdc116 T C 16: 16,961,903 (GRCm39) E15G probably damaging Het
Ccdc175 T C 12: 72,182,739 (GRCm39) N427D possibly damaging Het
Cfap53 A G 18: 74,432,247 (GRCm39) H45R probably benign Het
Chd3 A G 11: 69,240,732 (GRCm39) L1569P probably damaging Het
Cntn2 G A 1: 132,443,918 (GRCm39) Q457* probably null Het
Coro1a A T 7: 126,300,585 (GRCm39) probably benign Het
Cracr2b T A 7: 141,043,672 (GRCm39) L91Q probably damaging Het
Ctdspl T C 9: 118,849,114 (GRCm39) probably null Het
Dip2b T A 15: 100,067,193 (GRCm39) L565Q probably damaging Het
Dip2c T A 13: 9,671,939 (GRCm39) C1004S probably damaging Het
Dnah11 A T 12: 118,009,257 (GRCm39) I2135N possibly damaging Het
Dnah14 A G 1: 181,596,972 (GRCm39) probably benign Het
Dusp8 T C 7: 141,635,791 (GRCm39) probably benign Het
Fer1l6 T C 15: 58,534,636 (GRCm39) Y1828H probably damaging Het
Flvcr1 A G 1: 190,740,388 (GRCm39) V544A probably benign Het
Fsd1l T C 4: 53,687,209 (GRCm39) V311A probably benign Het
Glud1 G A 14: 34,056,225 (GRCm39) G300S probably benign Het
Gm4847 C T 1: 166,458,055 (GRCm39) V433I probably benign Het
Gstm3 T G 3: 107,875,156 (GRCm39) Y62S probably damaging Het
Gtse1 C T 15: 85,746,636 (GRCm39) P151S probably benign Het
Herc2 T C 7: 55,857,560 (GRCm39) S4048P probably benign Het
Hp1bp3 T A 4: 137,948,994 (GRCm39) I19K probably benign Het
Htr7 C A 19: 36,018,940 (GRCm39) probably benign Het
Il1a C T 2: 129,150,994 (GRCm39) D10N probably damaging Het
Il22ra2 A T 10: 19,500,206 (GRCm39) N39I probably damaging Het
Kcnn4 T C 7: 24,078,680 (GRCm39) C267R possibly damaging Het
Larp1 A G 11: 57,946,299 (GRCm39) K879R possibly damaging Het
Lcn5 T A 2: 25,551,417 (GRCm39) probably benign Het
Lep T A 6: 29,068,971 (GRCm39) C7* probably null Het
Magi2 A T 5: 20,816,053 (GRCm39) Y747F probably benign Het
Mast4 T C 13: 102,878,566 (GRCm39) T1223A probably damaging Het
Mcc C T 18: 44,579,000 (GRCm39) E803K probably damaging Het
Mtmr4 T C 11: 87,502,334 (GRCm39) I796T probably benign Het
Myef2 A T 2: 124,950,898 (GRCm39) D312E probably benign Het
Myl3 A C 9: 110,596,997 (GRCm39) D119A probably damaging Het
Myo19 T A 11: 84,778,995 (GRCm39) probably null Het
Naa15 T G 3: 51,377,640 (GRCm39) H763Q probably damaging Het
Pde5a C T 3: 122,618,551 (GRCm39) probably benign Het
Plpp2 C T 10: 79,363,078 (GRCm39) R184H probably benign Het
Rab19 T G 6: 39,366,621 (GRCm39) L179V probably damaging Het
Rims2 T A 15: 39,398,362 (GRCm39) M1087K probably damaging Het
Riox2 C A 16: 59,309,730 (GRCm39) D361E probably benign Het
Sh3rf1 T A 8: 61,679,327 (GRCm39) V123E probably damaging Het
Slc35e1 A T 8: 73,238,553 (GRCm39) N318K probably damaging Het
Slc9a2 A T 1: 40,802,762 (GRCm39) E604V probably benign Het
Srp72 T C 5: 77,135,732 (GRCm39) S221P probably damaging Het
Tbx19 A T 1: 164,988,089 (GRCm39) S15T possibly damaging Het
Tcea2 A G 2: 181,327,610 (GRCm39) T112A probably benign Het
Tesk1 T A 4: 43,445,368 (GRCm39) D230E probably damaging Het
Tm4sf5 C T 11: 70,401,538 (GRCm39) A179V probably damaging Het
Tnr G T 1: 159,679,986 (GRCm39) G320V probably damaging Het
Trappc11 A T 8: 47,956,355 (GRCm39) C874S possibly damaging Het
Trpm3 T A 19: 22,891,810 (GRCm39) Y885N probably damaging Het
Unc5a T A 13: 55,150,692 (GRCm39) C505S probably damaging Het
Vmn1r28 G A 6: 58,242,702 (GRCm39) A182T probably benign Het
Xpo5 T C 17: 46,515,712 (GRCm39) probably benign Het
Zfp637 C A 6: 117,822,629 (GRCm39) H252Q probably damaging Het
Zfp646 T A 7: 127,479,903 (GRCm39) D693E probably damaging Het
Other mutations in Dnase1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00649:Dnase1 APN 16 3,856,888 (GRCm39) missense probably damaging 1.00
IGL00896:Dnase1 APN 16 3,857,076 (GRCm39) missense probably benign 0.00
IGL00983:Dnase1 APN 16 3,857,417 (GRCm39) missense possibly damaging 0.70
IGL02186:Dnase1 APN 16 3,856,896 (GRCm39) missense probably benign 0.18
IGL03373:Dnase1 APN 16 3,857,707 (GRCm39) missense probably damaging 1.00
R0009:Dnase1 UTSW 16 3,856,810 (GRCm39) missense probably damaging 1.00
R0355:Dnase1 UTSW 16 3,857,413 (GRCm39) missense probably damaging 1.00
R0467:Dnase1 UTSW 16 3,857,013 (GRCm39) missense probably damaging 1.00
R4964:Dnase1 UTSW 16 3,855,771 (GRCm39) intron probably benign
R4966:Dnase1 UTSW 16 3,855,771 (GRCm39) intron probably benign
R5014:Dnase1 UTSW 16 3,856,880 (GRCm39) nonsense probably null
R5621:Dnase1 UTSW 16 3,856,982 (GRCm39) missense probably benign 0.01
R5858:Dnase1 UTSW 16 3,857,513 (GRCm39) splice site probably benign
R6256:Dnase1 UTSW 16 3,855,485 (GRCm39) missense probably benign 0.06
R6519:Dnase1 UTSW 16 3,856,453 (GRCm39) missense probably damaging 1.00
R7002:Dnase1 UTSW 16 3,857,410 (GRCm39) missense possibly damaging 0.76
R7977:Dnase1 UTSW 16 3,855,834 (GRCm39) missense probably damaging 1.00
R7987:Dnase1 UTSW 16 3,855,834 (GRCm39) missense probably damaging 1.00
R8050:Dnase1 UTSW 16 3,855,861 (GRCm39) missense probably damaging 1.00
R9781:Dnase1 UTSW 16 3,857,054 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCACGATGGAGTCACAGCTTACAAC -3'
(R):5'- TGATGTCCTACCAGCAGACATGCC -3'

Sequencing Primer
(F):5'- TCCAGACCTCTAGAAGCCTGTG -3'
(R):5'- CTGTTGGTCCAGGGACAAAC -3'
Posted On 2013-05-23