Incidental Mutation 'R5324:Corin'
ID 405011
Institutional Source Beutler Lab
Gene Symbol Corin
Ensembl Gene ENSMUSG00000005220
Gene Name corin, serine peptidase
Synonyms Lrp4
MMRRC Submission 042907-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.267) question?
Stock # R5324 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 72457368-72661816 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 72592600 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 133 (C133R)
Ref Sequence ENSEMBL: ENSMUSP00000135511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005352] [ENSMUST00000167460] [ENSMUST00000175766] [ENSMUST00000176974] [ENSMUST00000177290]
AlphaFold Q9Z319
Predicted Effect probably damaging
Transcript: ENSMUST00000005352
AA Change: C266R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005352
Gene: ENSMUSG00000005220
AA Change: C266R

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
FRI 205 318 6.15e-11 SMART
LDLa 336 372 1.31e-8 SMART
LDLa 373 408 1.5e-8 SMART
LDLa 409 447 5.47e-11 SMART
LDLa 448 484 1.22e-8 SMART
low complexity region 508 521 N/A INTRINSIC
FRI 522 643 2.75e-31 SMART
LDLa 647 684 2.19e-10 SMART
LDLa 685 722 1.76e-5 SMART
LDLa 723 759 4.18e-7 SMART
SR 758 853 3.99e-10 SMART
Tryp_SPc 868 1097 5.45e-76 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167460
AA Change: C200R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127389
Gene: ENSMUSG00000005220
AA Change: C200R

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 139 252 6.15e-11 SMART
LDLa 270 306 1.31e-8 SMART
LDLa 307 342 1.5e-8 SMART
LDLa 343 381 5.47e-11 SMART
LDLa 382 418 1.22e-8 SMART
low complexity region 442 455 N/A INTRINSIC
FRI 456 577 2.75e-31 SMART
LDLa 581 618 2.19e-10 SMART
LDLa 619 656 1.76e-5 SMART
LDLa 657 693 4.18e-7 SMART
SR 692 787 3.99e-10 SMART
Tryp_SPc 802 1031 5.45e-76 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000175766
AA Change: C198R

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135889
Gene: ENSMUSG00000005220
AA Change: C198R

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
FRI 137 250 6.15e-11 SMART
LDLa 268 304 1.31e-8 SMART
LDLa 305 343 2.07e-11 SMART
low complexity region 367 380 N/A INTRINSIC
FRI 381 502 2.75e-31 SMART
LDLa 506 543 2.19e-10 SMART
LDLa 544 581 1.76e-5 SMART
LDLa 582 618 4.18e-7 SMART
SR 617 712 3.99e-10 SMART
Tryp_SPc 727 956 5.45e-76 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176974
AA Change: C200R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135722
Gene: ENSMUSG00000005220
AA Change: C200R

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 139 252 6.15e-11 SMART
LDLa 270 306 1.31e-8 SMART
LDLa 307 344 3.86e-11 SMART
LDLa 345 381 1.22e-8 SMART
low complexity region 405 418 N/A INTRINSIC
FRI 419 540 2.75e-31 SMART
LDLa 544 581 2.19e-10 SMART
LDLa 582 619 1.76e-5 SMART
LDLa 620 656 4.18e-7 SMART
SR 655 750 3.99e-10 SMART
Tryp_SPc 765 994 5.45e-76 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177290
AA Change: C133R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135511
Gene: ENSMUSG00000005220
AA Change: C133R

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 72 185 6.15e-11 SMART
LDLa 203 239 1.31e-8 SMART
LDLa 240 275 1.5e-8 SMART
LDLa 276 314 5.47e-11 SMART
LDLa 315 351 1.22e-8 SMART
low complexity region 375 388 N/A INTRINSIC
FRI 389 510 2.75e-31 SMART
LDLa 514 551 2.19e-10 SMART
LDLa 552 589 1.76e-5 SMART
LDLa 590 626 4.18e-7 SMART
SR 625 720 3.99e-10 SMART
Tryp_SPc 735 964 5.45e-76 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II transmembrane serine protease class of the trypsin superfamily. Members of this family are composed of multiple structurally distinct domains. The encoded protein converts pro-atrial natriuretic peptide to biologically active atrial natriuretic peptide, a cardiac hormone that regulates blood volume and pressure. This protein may also function as a pro-brain-type natriuretic peptide convertase. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display hypertension that is enhanced by high-salt diet and pregnancy, increased body weight, and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap10 C T 11: 61,807,015 (GRCm39) A72T probably damaging Het
Ap5b1 G A 19: 5,619,863 (GRCm39) E428K possibly damaging Het
Bmp2 C T 2: 133,403,279 (GRCm39) R277* probably null Het
Cbl A T 9: 44,065,551 (GRCm39) S659T probably damaging Het
Col14a1 A T 15: 55,201,841 (GRCm39) H43L unknown Het
Cyp1a1 A G 9: 57,609,652 (GRCm39) N401S probably benign Het
Dip2a T C 10: 76,132,227 (GRCm39) D508G probably damaging Het
Dnah2 T A 11: 69,348,819 (GRCm39) H2556L probably benign Het
Dock8 T C 19: 25,140,458 (GRCm39) F1333L probably benign Het
Epg5 A G 18: 78,005,660 (GRCm39) K717E possibly damaging Het
Fmn2 G A 1: 174,436,446 (GRCm39) probably benign Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Hbp1 T C 12: 31,978,617 (GRCm39) N510S probably damaging Het
Lrguk T C 6: 34,050,732 (GRCm39) S397P possibly damaging Het
Mmrn1 A T 6: 60,953,570 (GRCm39) D617V probably damaging Het
Mroh9 C G 1: 162,888,329 (GRCm39) G249R probably damaging Het
N6amt1 A G 16: 87,151,241 (GRCm39) D34G probably damaging Het
Nktr A T 9: 121,556,412 (GRCm39) D30V probably damaging Het
Or52ab7 T A 7: 102,978,257 (GRCm39) M188K probably damaging Het
Or5w8 A T 2: 87,688,040 (GRCm39) I174F probably damaging Het
Or6c212 T A 10: 129,558,814 (GRCm39) I200L probably benign Het
Pabpc1 A G 15: 36,600,869 (GRCm39) F314L probably damaging Het
Papln G A 12: 83,821,345 (GRCm39) V226M probably damaging Het
Parp12 A T 6: 39,079,546 (GRCm39) D321E probably damaging Het
Plch2 T A 4: 155,068,991 (GRCm39) T1107S probably benign Het
Psma2 T C 13: 14,799,802 (GRCm39) L182P probably damaging Het
Rcl1 A G 19: 29,105,401 (GRCm39) Y196C probably benign Het
Rdh16 G A 10: 127,637,136 (GRCm39) V24M probably damaging Het
Rpe65 A G 3: 159,310,041 (GRCm39) T105A possibly damaging Het
Serpini1 T C 3: 75,547,601 (GRCm39) I371T probably damaging Het
Tet2 T C 3: 133,191,674 (GRCm39) N920S probably benign Het
Tmem71 C T 15: 66,427,063 (GRCm39) S44N probably benign Het
Tmprss11f T A 5: 86,704,837 (GRCm39) D27V possibly damaging Het
Zfp747l1 G T 7: 126,984,079 (GRCm39) probably benign Het
Zxdc T A 6: 90,350,782 (GRCm39) I411N probably damaging Het
Other mutations in Corin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Corin APN 5 72,462,231 (GRCm39) missense probably damaging 1.00
IGL01114:Corin APN 5 72,462,354 (GRCm39) missense probably damaging 1.00
IGL01351:Corin APN 5 72,496,334 (GRCm39) missense probably damaging 1.00
IGL01516:Corin APN 5 72,611,830 (GRCm39) nonsense probably null
IGL01785:Corin APN 5 72,497,219 (GRCm39) missense probably damaging 1.00
IGL01786:Corin APN 5 72,497,219 (GRCm39) missense probably damaging 1.00
IGL01845:Corin APN 5 72,511,282 (GRCm39) missense probably damaging 1.00
IGL02097:Corin APN 5 72,529,489 (GRCm39) missense probably damaging 1.00
IGL02629:Corin APN 5 72,490,016 (GRCm39) missense probably damaging 1.00
IGL03085:Corin APN 5 72,511,273 (GRCm39) missense probably damaging 1.00
IGL03120:Corin APN 5 72,518,032 (GRCm39) missense probably damaging 1.00
IGL03150:Corin APN 5 72,460,201 (GRCm39) missense probably damaging 1.00
IGL03183:Corin APN 5 72,458,929 (GRCm39) missense probably damaging 0.99
IGL03185:Corin APN 5 72,490,124 (GRCm39) missense probably damaging 1.00
IGL03408:Corin APN 5 72,500,304 (GRCm39) missense probably benign 0.40
alpaca UTSW 5 72,661,295 (GRCm39) missense possibly damaging 0.85
R0078:Corin UTSW 5 72,611,816 (GRCm39) missense possibly damaging 0.77
R0724:Corin UTSW 5 72,490,138 (GRCm39) splice site probably benign
R1065:Corin UTSW 5 72,458,993 (GRCm39) nonsense probably null
R1301:Corin UTSW 5 72,462,276 (GRCm39) missense possibly damaging 0.81
R1466:Corin UTSW 5 72,460,133 (GRCm39) critical splice donor site probably null
R1466:Corin UTSW 5 72,460,133 (GRCm39) critical splice donor site probably null
R1520:Corin UTSW 5 72,488,238 (GRCm39) missense probably damaging 1.00
R1584:Corin UTSW 5 72,460,133 (GRCm39) critical splice donor site probably null
R1617:Corin UTSW 5 72,661,295 (GRCm39) missense possibly damaging 0.85
R1912:Corin UTSW 5 72,515,746 (GRCm39) missense probably damaging 1.00
R2059:Corin UTSW 5 72,473,394 (GRCm39) missense possibly damaging 0.76
R2173:Corin UTSW 5 72,661,422 (GRCm39) missense probably benign 0.01
R2242:Corin UTSW 5 72,490,054 (GRCm39) missense probably damaging 1.00
R2373:Corin UTSW 5 72,496,381 (GRCm39) missense probably damaging 1.00
R2850:Corin UTSW 5 72,462,298 (GRCm39) missense probably damaging 1.00
R3683:Corin UTSW 5 72,488,198 (GRCm39) missense probably damaging 1.00
R3684:Corin UTSW 5 72,488,198 (GRCm39) missense probably damaging 1.00
R3790:Corin UTSW 5 72,592,641 (GRCm39) missense probably benign 0.38
R3847:Corin UTSW 5 72,579,508 (GRCm39) missense probably benign 0.13
R3926:Corin UTSW 5 72,529,473 (GRCm39) missense probably damaging 1.00
R3939:Corin UTSW 5 72,497,222 (GRCm39) missense possibly damaging 0.80
R3945:Corin UTSW 5 72,515,767 (GRCm39) missense probably damaging 1.00
R4079:Corin UTSW 5 72,661,226 (GRCm39) missense probably benign 0.03
R4224:Corin UTSW 5 72,500,451 (GRCm39) missense probably damaging 1.00
R4473:Corin UTSW 5 72,496,400 (GRCm39) missense probably damaging 1.00
R4585:Corin UTSW 5 72,487,042 (GRCm39) missense probably damaging 1.00
R4586:Corin UTSW 5 72,487,042 (GRCm39) missense probably damaging 1.00
R4849:Corin UTSW 5 72,460,178 (GRCm39) missense probably damaging 1.00
R4926:Corin UTSW 5 72,529,525 (GRCm39) missense probably damaging 1.00
R5080:Corin UTSW 5 72,511,194 (GRCm39) intron probably benign
R5138:Corin UTSW 5 72,496,402 (GRCm39) missense probably damaging 1.00
R5262:Corin UTSW 5 72,462,298 (GRCm39) missense probably damaging 1.00
R5268:Corin UTSW 5 72,500,362 (GRCm39) missense probably damaging 1.00
R5302:Corin UTSW 5 72,473,441 (GRCm39) missense probably benign 0.07
R5307:Corin UTSW 5 72,514,321 (GRCm39) missense probably damaging 1.00
R5352:Corin UTSW 5 72,462,376 (GRCm39) missense probably benign 0.04
R5373:Corin UTSW 5 72,462,296 (GRCm39) missense probably damaging 1.00
R5374:Corin UTSW 5 72,462,296 (GRCm39) missense probably damaging 1.00
R5484:Corin UTSW 5 72,515,827 (GRCm39) missense probably benign 0.15
R5502:Corin UTSW 5 72,473,449 (GRCm39) nonsense probably null
R5544:Corin UTSW 5 72,462,357 (GRCm39) nonsense probably null
R5682:Corin UTSW 5 72,579,497 (GRCm39) missense possibly damaging 0.85
R5818:Corin UTSW 5 72,592,738 (GRCm39) missense probably benign 0.00
R5992:Corin UTSW 5 72,473,732 (GRCm39) missense probably benign 0.01
R6115:Corin UTSW 5 72,518,072 (GRCm39) missense probably damaging 1.00
R6181:Corin UTSW 5 72,529,439 (GRCm39) critical splice donor site probably null
R6317:Corin UTSW 5 72,496,388 (GRCm39) missense probably damaging 1.00
R7053:Corin UTSW 5 72,458,870 (GRCm39) missense probably benign 0.28
R7242:Corin UTSW 5 72,462,398 (GRCm39) missense probably benign 0.14
R7452:Corin UTSW 5 72,592,590 (GRCm39) missense possibly damaging 0.94
R7783:Corin UTSW 5 72,458,967 (GRCm39) missense probably benign 0.26
R7903:Corin UTSW 5 72,458,843 (GRCm39) missense probably benign 0.00
R7956:Corin UTSW 5 72,579,530 (GRCm39) missense probably damaging 0.99
R8007:Corin UTSW 5 72,473,446 (GRCm39) missense probably damaging 0.96
R8125:Corin UTSW 5 72,515,806 (GRCm39) missense probably damaging 0.96
R8215:Corin UTSW 5 72,462,361 (GRCm39) missense probably damaging 1.00
R8251:Corin UTSW 5 72,514,269 (GRCm39) missense probably damaging 1.00
R8364:Corin UTSW 5 72,462,274 (GRCm39) missense probably benign
R8505:Corin UTSW 5 72,592,750 (GRCm39) missense probably benign 0.21
R8746:Corin UTSW 5 72,592,695 (GRCm39) missense probably benign 0.31
R8887:Corin UTSW 5 72,486,953 (GRCm39) critical splice donor site probably null
R9484:Corin UTSW 5 72,497,280 (GRCm39) missense probably damaging 1.00
R9640:Corin UTSW 5 72,592,597 (GRCm39) missense probably benign
Z1177:Corin UTSW 5 72,611,836 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGTGTCCCCTGAAAGCAAC -3'
(R):5'- AGGCACCTGCATGAACATC -3'

Sequencing Primer
(F):5'- CTTCCCGTAAAACATGAATCTGG -3'
(R):5'- TGCATGAACATCACTCACAGC -3'
Posted On 2016-07-22