Incidental Mutation 'R5324:Tmprss11f'
ID 405012
Institutional Source Beutler Lab
Gene Symbol Tmprss11f
Ensembl Gene ENSMUSG00000048764
Gene Name transmembrane protease, serine 11f
Synonyms 4732406D01Rik
MMRRC Submission 042907-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R5324 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 86669757-86780283 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 86704837 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 27 (D27V)
Ref Sequence ENSEMBL: ENSMUSP00000112252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116553]
AlphaFold Q8BHM9
Predicted Effect possibly damaging
Transcript: ENSMUST00000116553
AA Change: D27V

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112252
Gene: ENSMUSG00000048764
AA Change: D27V

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
SEA 56 168 4.62e-2 SMART
low complexity region 192 203 N/A INTRINSIC
Tryp_SPc 206 433 8.7e-84 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap10 C T 11: 61,807,015 (GRCm39) A72T probably damaging Het
Ap5b1 G A 19: 5,619,863 (GRCm39) E428K possibly damaging Het
Bmp2 C T 2: 133,403,279 (GRCm39) R277* probably null Het
Cbl A T 9: 44,065,551 (GRCm39) S659T probably damaging Het
Col14a1 A T 15: 55,201,841 (GRCm39) H43L unknown Het
Corin A G 5: 72,592,600 (GRCm39) C133R probably damaging Het
Cyp1a1 A G 9: 57,609,652 (GRCm39) N401S probably benign Het
Dip2a T C 10: 76,132,227 (GRCm39) D508G probably damaging Het
Dnah2 T A 11: 69,348,819 (GRCm39) H2556L probably benign Het
Dock8 T C 19: 25,140,458 (GRCm39) F1333L probably benign Het
Epg5 A G 18: 78,005,660 (GRCm39) K717E possibly damaging Het
Fmn2 G A 1: 174,436,446 (GRCm39) probably benign Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Hbp1 T C 12: 31,978,617 (GRCm39) N510S probably damaging Het
Lrguk T C 6: 34,050,732 (GRCm39) S397P possibly damaging Het
Mmrn1 A T 6: 60,953,570 (GRCm39) D617V probably damaging Het
Mroh9 C G 1: 162,888,329 (GRCm39) G249R probably damaging Het
N6amt1 A G 16: 87,151,241 (GRCm39) D34G probably damaging Het
Nktr A T 9: 121,556,412 (GRCm39) D30V probably damaging Het
Or52ab7 T A 7: 102,978,257 (GRCm39) M188K probably damaging Het
Or5w8 A T 2: 87,688,040 (GRCm39) I174F probably damaging Het
Or6c212 T A 10: 129,558,814 (GRCm39) I200L probably benign Het
Pabpc1 A G 15: 36,600,869 (GRCm39) F314L probably damaging Het
Papln G A 12: 83,821,345 (GRCm39) V226M probably damaging Het
Parp12 A T 6: 39,079,546 (GRCm39) D321E probably damaging Het
Plch2 T A 4: 155,068,991 (GRCm39) T1107S probably benign Het
Psma2 T C 13: 14,799,802 (GRCm39) L182P probably damaging Het
Rcl1 A G 19: 29,105,401 (GRCm39) Y196C probably benign Het
Rdh16 G A 10: 127,637,136 (GRCm39) V24M probably damaging Het
Rpe65 A G 3: 159,310,041 (GRCm39) T105A possibly damaging Het
Serpini1 T C 3: 75,547,601 (GRCm39) I371T probably damaging Het
Tet2 T C 3: 133,191,674 (GRCm39) N920S probably benign Het
Tmem71 C T 15: 66,427,063 (GRCm39) S44N probably benign Het
Zfp747l1 G T 7: 126,984,079 (GRCm39) probably benign Het
Zxdc T A 6: 90,350,782 (GRCm39) I411N probably damaging Het
Other mutations in Tmprss11f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Tmprss11f APN 5 86,671,924 (GRCm39) missense probably damaging 1.00
IGL01453:Tmprss11f APN 5 86,692,691 (GRCm39) nonsense probably null
IGL02406:Tmprss11f APN 5 86,681,525 (GRCm39) missense probably damaging 1.00
IGL03294:Tmprss11f APN 5 86,685,966 (GRCm39) missense probably damaging 1.00
R0122:Tmprss11f UTSW 5 86,681,484 (GRCm39) splice site probably benign
R0322:Tmprss11f UTSW 5 86,739,275 (GRCm39) missense probably benign 0.06
R0418:Tmprss11f UTSW 5 86,704,870 (GRCm39) missense probably benign 0.16
R1936:Tmprss11f UTSW 5 86,692,723 (GRCm39) missense probably benign 0.23
R2002:Tmprss11f UTSW 5 86,687,627 (GRCm39) splice site probably benign
R2008:Tmprss11f UTSW 5 86,739,265 (GRCm39) splice site probably null
R2260:Tmprss11f UTSW 5 86,739,269 (GRCm39) missense probably benign 0.22
R4109:Tmprss11f UTSW 5 86,677,795 (GRCm39) missense possibly damaging 0.89
R4584:Tmprss11f UTSW 5 86,687,553 (GRCm39) critical splice donor site probably null
R4983:Tmprss11f UTSW 5 86,685,858 (GRCm39) missense probably benign 0.06
R5034:Tmprss11f UTSW 5 86,739,243 (GRCm39) intron probably benign
R5116:Tmprss11f UTSW 5 86,687,555 (GRCm39) missense probably benign 0.01
R5254:Tmprss11f UTSW 5 86,685,892 (GRCm39) missense probably benign 0.00
R5410:Tmprss11f UTSW 5 86,677,965 (GRCm39) missense probably damaging 0.99
R5441:Tmprss11f UTSW 5 86,676,062 (GRCm39) missense probably damaging 1.00
R6143:Tmprss11f UTSW 5 86,687,558 (GRCm39) missense probably benign
R6178:Tmprss11f UTSW 5 86,704,837 (GRCm39) missense probably benign 0.00
R6239:Tmprss11f UTSW 5 86,681,636 (GRCm39) missense probably damaging 0.99
R6447:Tmprss11f UTSW 5 86,676,086 (GRCm39) missense probably damaging 1.00
R6817:Tmprss11f UTSW 5 86,704,793 (GRCm39) missense probably benign
R7243:Tmprss11f UTSW 5 86,677,975 (GRCm39) missense probably damaging 1.00
R7314:Tmprss11f UTSW 5 86,671,912 (GRCm39) missense possibly damaging 0.55
R7623:Tmprss11f UTSW 5 86,672,019 (GRCm39) missense probably damaging 1.00
R7708:Tmprss11f UTSW 5 86,672,028 (GRCm39) missense probably damaging 1.00
R7776:Tmprss11f UTSW 5 86,681,605 (GRCm39) missense probably benign 0.21
R7955:Tmprss11f UTSW 5 86,692,682 (GRCm39) missense probably benign 0.13
R8046:Tmprss11f UTSW 5 86,676,132 (GRCm39) missense probably damaging 1.00
R8147:Tmprss11f UTSW 5 86,677,769 (GRCm39) missense probably damaging 1.00
R8209:Tmprss11f UTSW 5 86,687,566 (GRCm39) missense probably damaging 1.00
R8219:Tmprss11f UTSW 5 86,677,878 (GRCm39) missense probably damaging 1.00
R8343:Tmprss11f UTSW 5 86,681,666 (GRCm39) missense probably benign 0.25
R8873:Tmprss11f UTSW 5 86,692,733 (GRCm39) missense probably damaging 0.98
R8889:Tmprss11f UTSW 5 86,687,618 (GRCm39) missense possibly damaging 0.86
R8892:Tmprss11f UTSW 5 86,687,618 (GRCm39) missense possibly damaging 0.86
R9465:Tmprss11f UTSW 5 86,685,876 (GRCm39) missense probably damaging 0.97
Z1176:Tmprss11f UTSW 5 86,676,054 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTTTCTGTTCTGAGCACAC -3'
(R):5'- AGAGTCAAGTAACCCAGTGTTC -3'

Sequencing Primer
(F):5'- CTGAGCACACTGTACTTTTACAACG -3'
(R):5'- GAGTCAAGTAACCCAGTGTTCTTAGC -3'
Posted On 2016-07-22