Incidental Mutation 'R5324:Lrguk'
ID405013
Institutional Source Beutler Lab
Gene Symbol Lrguk
Ensembl Gene ENSMUSG00000056215
Gene Nameleucine-rich repeats and guanylate kinase domain containing
Synonyms4921528H16Rik
MMRRC Submission 042907-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5324 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location34029448-34134034 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34073797 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 397 (S397P)
Ref Sequence ENSEMBL: ENSMUSP00000153993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070189] [ENSMUST00000228187]
Predicted Effect probably benign
Transcript: ENSMUST00000070189
AA Change: S397P

PolyPhen 2 Score 0.396 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000065146
Gene: ENSMUSG00000056215
AA Change: S397P

DomainStartEndE-ValueType
coiled coil region 75 113 N/A INTRINSIC
LRR 148 170 2.69e2 SMART
LRR 236 258 1.86e2 SMART
LRR 279 301 1.99e0 SMART
LRR 326 349 1.58e2 SMART
GuKc 414 600 6.84e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000228187
AA Change: S397P

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,907 probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ap5b1 G A 19: 5,569,835 E428K possibly damaging Het
Bmp2 C T 2: 133,561,359 R277* probably null Het
Cbl A T 9: 44,154,254 S659T probably damaging Het
Col14a1 A T 15: 55,338,445 H43L unknown Het
Corin A G 5: 72,435,257 C133R probably damaging Het
Cyp1a1 A G 9: 57,702,369 N401S probably benign Het
Dip2a T C 10: 76,296,393 D508G probably damaging Het
Dnah2 T A 11: 69,457,993 H2556L probably benign Het
Dock8 T C 19: 25,163,094 F1333L probably benign Het
Epg5 A G 18: 77,962,445 K717E possibly damaging Het
Fmn2 G A 1: 174,608,880 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hbp1 T C 12: 31,928,618 N510S probably damaging Het
Mmrn1 A T 6: 60,976,586 D617V probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
N6amt1 A G 16: 87,354,353 D34G probably damaging Het
Nktr A T 9: 121,727,346 D30V probably damaging Het
Olfr1151 A T 2: 87,857,696 I174F probably damaging Het
Olfr598 T A 7: 103,329,050 M188K probably damaging Het
Olfr805 T A 10: 129,722,945 I200L probably benign Het
Pabpc1 A G 15: 36,600,625 F314L probably damaging Het
Papln G A 12: 83,774,571 V226M probably damaging Het
Parp12 A T 6: 39,102,612 D321E probably damaging Het
Plch2 T A 4: 154,984,534 T1107S probably benign Het
Psma2 T C 13: 14,625,217 L182P probably damaging Het
Rcl1 A G 19: 29,128,001 Y196C probably benign Het
Rdh16 G A 10: 127,801,267 V24M probably damaging Het
Rpe65 A G 3: 159,604,404 T105A possibly damaging Het
Serpini1 T C 3: 75,640,294 I371T probably damaging Het
Tet2 T C 3: 133,485,913 N920S probably benign Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tmprss11f T A 5: 86,556,978 D27V possibly damaging Het
Zxdc T A 6: 90,373,800 I411N probably damaging Het
Other mutations in Lrguk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Lrguk APN 6 34043429 missense probably damaging 1.00
IGL00566:Lrguk APN 6 34056174 missense probably damaging 1.00
IGL01720:Lrguk APN 6 34043477 missense probably damaging 1.00
IGL02325:Lrguk APN 6 34129179 missense probably benign 0.31
IGL02484:Lrguk APN 6 34092791 missense probably damaging 1.00
IGL02493:Lrguk APN 6 34129192 missense probably benign 0.03
IGL02636:Lrguk APN 6 34090188 missense probably damaging 1.00
IGL03278:Lrguk APN 6 34116446 missense possibly damaging 0.80
R0031:Lrguk UTSW 6 34043496 missense probably damaging 0.99
R1069:Lrguk UTSW 6 34048883 missense possibly damaging 0.63
R1487:Lrguk UTSW 6 34062360 missense probably benign 0.01
R1568:Lrguk UTSW 6 34086438 missense probably damaging 1.00
R1604:Lrguk UTSW 6 34072370 missense possibly damaging 0.67
R1847:Lrguk UTSW 6 34133387 missense possibly damaging 0.52
R2045:Lrguk UTSW 6 34071068 missense probably damaging 1.00
R2107:Lrguk UTSW 6 34062361 missense probably benign 0.15
R2125:Lrguk UTSW 6 34092902 missense probably benign 0.05
R2136:Lrguk UTSW 6 34043519 missense probably benign 0.00
R2997:Lrguk UTSW 6 34073762 missense probably damaging 0.98
R3847:Lrguk UTSW 6 34073768 missense probably damaging 1.00
R3849:Lrguk UTSW 6 34073768 missense probably damaging 1.00
R4626:Lrguk UTSW 6 34129223 missense probably benign 0.00
R4718:Lrguk UTSW 6 34029496 missense probably benign 0.02
R4778:Lrguk UTSW 6 34056080 missense probably damaging 1.00
R4841:Lrguk UTSW 6 34092867 missense probably damaging 0.98
R5450:Lrguk UTSW 6 34071061 missense probably damaging 1.00
R5741:Lrguk UTSW 6 34048867 missense probably damaging 0.99
R5939:Lrguk UTSW 6 34078753 missense probably damaging 1.00
R5997:Lrguk UTSW 6 34129143 missense probably damaging 0.99
R6786:Lrguk UTSW 6 34095587 missense probably benign 0.11
R6802:Lrguk UTSW 6 34062457 missense probably damaging 1.00
R7081:Lrguk UTSW 6 34102139 missense probably benign 0.01
R7303:Lrguk UTSW 6 34029476 missense probably benign 0.00
R7316:Lrguk UTSW 6 34103256 missense unknown
R7473:Lrguk UTSW 6 34029695 missense probably benign 0.01
R7543:Lrguk UTSW 6 34048935 nonsense probably null
R7613:Lrguk UTSW 6 34101748 missense possibly damaging 0.68
R7716:Lrguk UTSW 6 34095539 missense probably damaging 1.00
R7900:Lrguk UTSW 6 34129194 missense probably benign 0.01
R8012:Lrguk UTSW 6 34056103 missense probably benign 0.00
R8251:Lrguk UTSW 6 34116439 missense probably benign 0.00
R8324:Lrguk UTSW 6 34102571 missense probably benign 0.03
X0057:Lrguk UTSW 6 34078747 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TTTTGGGAAAGTTAGAGTTGACCAGAG -3'
(R):5'- TGAGAAAGCAGCTTCCACG -3'

Sequencing Primer
(F):5'- GGACCACGTGACTTACCTTG -3'
(R):5'- AAGCAGCTTCCACGGGGAC -3'
Posted On2016-07-22