Incidental Mutation 'R5324:Mmrn1'
ID 405015
Institutional Source Beutler Lab
Gene Symbol Mmrn1
Ensembl Gene ENSMUSG00000054641
Gene Name multimerin 1
Synonyms 4921530G03Rik, Emilin4
MMRRC Submission 042907-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5324 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 60924976-60989378 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 60976586 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 617 (D617V)
Ref Sequence ENSEMBL: ENSMUSP00000145156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129603] [ENSMUST00000204333]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000129603
AA Change: D617V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119609
Gene: ENSMUSG00000054641
AA Change: D617V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Pfam:EMI 193 262 3.3e-12 PFAM
coiled coil region 303 338 N/A INTRINSIC
coiled coil region 658 688 N/A INTRINSIC
coiled coil region 808 846 N/A INTRINSIC
low complexity region 981 992 N/A INTRINSIC
EGF 1026 1059 1.62e-5 SMART
C1Q 1076 1210 6.74e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204333
AA Change: D617V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145156
Gene: ENSMUSG00000054641
AA Change: D617V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Pfam:EMI 193 262 7.7e-13 PFAM
coiled coil region 303 338 N/A INTRINSIC
coiled coil region 658 688 N/A INTRINSIC
coiled coil region 808 846 N/A INTRINSIC
low complexity region 981 992 N/A INTRINSIC
EGF 1025 1058 1.62e-5 SMART
C1Q 1075 1209 6.74e-49 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,907 probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ap5b1 G A 19: 5,569,835 E428K possibly damaging Het
Bmp2 C T 2: 133,561,359 R277* probably null Het
Cbl A T 9: 44,154,254 S659T probably damaging Het
Col14a1 A T 15: 55,338,445 H43L unknown Het
Corin A G 5: 72,435,257 C133R probably damaging Het
Cyp1a1 A G 9: 57,702,369 N401S probably benign Het
Dip2a T C 10: 76,296,393 D508G probably damaging Het
Dnah2 T A 11: 69,457,993 H2556L probably benign Het
Dock8 T C 19: 25,163,094 F1333L probably benign Het
Epg5 A G 18: 77,962,445 K717E possibly damaging Het
Fmn2 G A 1: 174,608,880 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hbp1 T C 12: 31,928,618 N510S probably damaging Het
Lrguk T C 6: 34,073,797 S397P possibly damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
N6amt1 A G 16: 87,354,353 D34G probably damaging Het
Nktr A T 9: 121,727,346 D30V probably damaging Het
Olfr1151 A T 2: 87,857,696 I174F probably damaging Het
Olfr598 T A 7: 103,329,050 M188K probably damaging Het
Olfr805 T A 10: 129,722,945 I200L probably benign Het
Pabpc1 A G 15: 36,600,625 F314L probably damaging Het
Papln G A 12: 83,774,571 V226M probably damaging Het
Parp12 A T 6: 39,102,612 D321E probably damaging Het
Plch2 T A 4: 154,984,534 T1107S probably benign Het
Psma2 T C 13: 14,625,217 L182P probably damaging Het
Rcl1 A G 19: 29,128,001 Y196C probably benign Het
Rdh16 G A 10: 127,801,267 V24M probably damaging Het
Rpe65 A G 3: 159,604,404 T105A possibly damaging Het
Serpini1 T C 3: 75,640,294 I371T probably damaging Het
Tet2 T C 3: 133,485,913 N920S probably benign Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tmprss11f T A 5: 86,556,978 D27V possibly damaging Het
Zxdc T A 6: 90,373,800 I411N probably damaging Het
Other mutations in Mmrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Mmrn1 APN 6 60977513 missense probably benign
IGL00742:Mmrn1 APN 6 60958120 missense probably damaging 1.00
IGL00917:Mmrn1 APN 6 60975910 nonsense probably null
IGL01121:Mmrn1 APN 6 60975944 missense possibly damaging 0.46
IGL01393:Mmrn1 APN 6 60960708 splice site probably benign
IGL01697:Mmrn1 APN 6 60976493 missense possibly damaging 0.46
IGL01737:Mmrn1 APN 6 60977161 missense probably benign
IGL01944:Mmrn1 APN 6 60971183 critical splice donor site probably null
IGL01987:Mmrn1 APN 6 60944573 missense probably benign 0.31
IGL02005:Mmrn1 APN 6 60960744 missense probably damaging 1.00
IGL02190:Mmrn1 APN 6 60987193 missense probably benign 0.13
IGL02335:Mmrn1 APN 6 60977147 missense possibly damaging 0.79
IGL02421:Mmrn1 APN 6 60944822 missense probably benign 0.00
IGL02530:Mmrn1 APN 6 60958176 missense possibly damaging 0.73
IGL02709:Mmrn1 APN 6 60973046 missense probably damaging 1.00
IGL03139:Mmrn1 APN 6 60976340 missense probably damaging 0.99
IGL03228:Mmrn1 APN 6 60944892 missense probably benign 0.02
IGL03272:Mmrn1 APN 6 60988435 missense probably damaging 1.00
IGL03410:Mmrn1 APN 6 60975835 missense probably benign 0.36
H8562:Mmrn1 UTSW 6 60958180 missense probably damaging 0.98
K2124:Mmrn1 UTSW 6 60976033 missense possibly damaging 0.87
R0145:Mmrn1 UTSW 6 60973010 missense probably damaging 1.00
R0164:Mmrn1 UTSW 6 60975815 splice site probably benign
R0352:Mmrn1 UTSW 6 60944971 missense probably benign 0.03
R0400:Mmrn1 UTSW 6 60977115 missense probably benign 0.00
R0538:Mmrn1 UTSW 6 60976469 missense probably benign 0.00
R0907:Mmrn1 UTSW 6 60973119 missense probably benign 0.09
R1117:Mmrn1 UTSW 6 60976325 missense possibly damaging 0.51
R1383:Mmrn1 UTSW 6 60976322 missense probably damaging 1.00
R1542:Mmrn1 UTSW 6 60945118 missense probably damaging 0.98
R1591:Mmrn1 UTSW 6 60944771 nonsense probably null
R1599:Mmrn1 UTSW 6 60945037 missense probably benign
R1733:Mmrn1 UTSW 6 60977101 missense probably benign 0.00
R2005:Mmrn1 UTSW 6 60976084 missense possibly damaging 0.88
R2056:Mmrn1 UTSW 6 60944805 missense probably benign 0.00
R2144:Mmrn1 UTSW 6 60945075 missense possibly damaging 0.54
R2299:Mmrn1 UTSW 6 60976441 missense probably damaging 0.99
R3836:Mmrn1 UTSW 6 60944847 missense probably benign
R3837:Mmrn1 UTSW 6 60944847 missense probably benign
R4206:Mmrn1 UTSW 6 60958180 missense probably damaging 0.98
R4414:Mmrn1 UTSW 6 60944586 missense probably damaging 1.00
R4590:Mmrn1 UTSW 6 60960813 missense probably damaging 1.00
R4707:Mmrn1 UTSW 6 60988473 missense probably benign 0.12
R4820:Mmrn1 UTSW 6 60973043 missense probably benign 0.04
R4880:Mmrn1 UTSW 6 60976439 missense probably benign 0.15
R5166:Mmrn1 UTSW 6 60976490 missense probably benign 0.04
R5887:Mmrn1 UTSW 6 60987074 missense probably benign
R5917:Mmrn1 UTSW 6 60973150 critical splice donor site probably null
R6108:Mmrn1 UTSW 6 60975976 missense possibly damaging 0.83
R6539:Mmrn1 UTSW 6 60987184 missense probably benign 0.01
R6996:Mmrn1 UTSW 6 60977383 missense probably benign 0.04
R7064:Mmrn1 UTSW 6 60988540 nonsense probably null
R7073:Mmrn1 UTSW 6 60988427 missense probably damaging 1.00
R7213:Mmrn1 UTSW 6 60944543 start gained probably benign
R7256:Mmrn1 UTSW 6 60976114 missense probably damaging 0.98
R7324:Mmrn1 UTSW 6 60944933 nonsense probably null
R7350:Mmrn1 UTSW 6 60976336 nonsense probably null
R7388:Mmrn1 UTSW 6 60976252 missense probably benign 0.43
R7652:Mmrn1 UTSW 6 60977506 missense probably benign 0.14
R7664:Mmrn1 UTSW 6 60976705 missense probably benign 0.44
R7810:Mmrn1 UTSW 6 60976325 missense probably benign 0.18
R7832:Mmrn1 UTSW 6 60987060 splice site probably null
R7979:Mmrn1 UTSW 6 60975977 missense probably damaging 0.96
R8071:Mmrn1 UTSW 6 60944524 start gained probably benign
R8130:Mmrn1 UTSW 6 60960723 missense probably damaging 1.00
R8277:Mmrn1 UTSW 6 60977236 missense probably benign 0.19
R8353:Mmrn1 UTSW 6 60988377 missense probably damaging 1.00
R8453:Mmrn1 UTSW 6 60988377 missense probably damaging 1.00
R8472:Mmrn1 UTSW 6 60988396 missense probably damaging 1.00
R8758:Mmrn1 UTSW 6 60987209 missense possibly damaging 0.54
R8803:Mmrn1 UTSW 6 60988287 missense probably damaging 1.00
R8879:Mmrn1 UTSW 6 60976529 missense probably damaging 0.99
R8907:Mmrn1 UTSW 6 60976093 missense probably damaging 1.00
R8983:Mmrn1 UTSW 6 60976058 missense probably benign 0.04
R9200:Mmrn1 UTSW 6 60976876 missense probably damaging 1.00
R9287:Mmrn1 UTSW 6 60975955 missense probably damaging 1.00
R9387:Mmrn1 UTSW 6 60958192 nonsense probably null
R9612:Mmrn1 UTSW 6 60976424 missense probably damaging 0.96
R9674:Mmrn1 UTSW 6 60971088 nonsense probably null
X0026:Mmrn1 UTSW 6 60976013 missense probably benign 0.09
Z1176:Mmrn1 UTSW 6 60945034 missense probably benign 0.37
Z1177:Mmrn1 UTSW 6 60987098 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCCAAGAGAGCAAGATCAGC -3'
(R):5'- CTCTCAAAGGCTTCACCACG -3'

Sequencing Primer
(F):5'- AGATCAGCAACCTTACCATCCTTTTG -3'
(R):5'- AAGGCTTCACCACGGCTCTG -3'
Posted On 2016-07-22