Incidental Mutation 'R5324:Zxdc'
ID 405016
Institutional Source Beutler Lab
Gene Symbol Zxdc
Ensembl Gene ENSMUSG00000034430
Gene Name ZXD family zinc finger C
Synonyms B930086F11Rik
MMRRC Submission 042907-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock # R5324 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 90369492-90403490 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 90373800 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 411 (I411N)
Ref Sequence ENSEMBL: ENSMUSP00000109167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045740] [ENSMUST00000075117] [ENSMUST00000113539]
AlphaFold Q8C8V1
Predicted Effect probably damaging
Transcript: ENSMUST00000045740
AA Change: I411N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036329
Gene: ENSMUSG00000034430
AA Change: I411N

DomainStartEndE-ValueType
low complexity region 22 73 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 134 152 N/A INTRINSIC
ZnF_C2H2 176 200 4.79e-3 SMART
ZnF_C2H2 209 233 4.3e-5 SMART
ZnF_C2H2 239 263 4.3e-5 SMART
ZnF_C2H2 269 291 1.69e-3 SMART
ZnF_C2H2 298 322 1.82e-3 SMART
ZnF_C2H2 329 353 1.26e-2 SMART
ZnF_C2H2 359 383 1.36e-2 SMART
ZnF_C2H2 389 413 5.21e-4 SMART
ZnF_C2H2 419 443 4.72e-2 SMART
ZnF_C2H2 452 477 3.07e-1 SMART
low complexity region 487 502 N/A INTRINSIC
low complexity region 635 651 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075117
AA Change: I411N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074619
Gene: ENSMUSG00000034430
AA Change: I411N

DomainStartEndE-ValueType
low complexity region 22 73 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 134 152 N/A INTRINSIC
ZnF_C2H2 176 200 4.79e-3 SMART
ZnF_C2H2 209 233 4.3e-5 SMART
ZnF_C2H2 239 263 4.3e-5 SMART
ZnF_C2H2 269 291 1.69e-3 SMART
ZnF_C2H2 298 322 1.82e-3 SMART
ZnF_C2H2 329 353 1.26e-2 SMART
ZnF_C2H2 359 383 1.36e-2 SMART
ZnF_C2H2 389 413 5.21e-4 SMART
ZnF_C2H2 419 443 4.72e-2 SMART
ZnF_C2H2 452 477 3.07e-1 SMART
low complexity region 487 502 N/A INTRINSIC
low complexity region 635 651 N/A INTRINSIC
low complexity region 799 811 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113539
AA Change: I411N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109167
Gene: ENSMUSG00000034430
AA Change: I411N

DomainStartEndE-ValueType
low complexity region 44 95 N/A INTRINSIC
low complexity region 127 137 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
ZnF_C2H2 198 222 4.79e-3 SMART
ZnF_C2H2 231 255 4.3e-5 SMART
ZnF_C2H2 261 285 4.3e-5 SMART
ZnF_C2H2 291 313 1.69e-3 SMART
ZnF_C2H2 320 344 1.82e-3 SMART
ZnF_C2H2 351 375 1.26e-2 SMART
ZnF_C2H2 381 405 1.36e-2 SMART
ZnF_C2H2 411 435 5.21e-4 SMART
ZnF_C2H2 441 465 4.72e-2 SMART
ZnF_C2H2 474 499 3.07e-1 SMART
low complexity region 509 524 N/A INTRINSIC
low complexity region 657 673 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137483
Predicted Effect probably benign
Transcript: ENSMUST00000203493
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,907 probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ap5b1 G A 19: 5,569,835 E428K possibly damaging Het
Bmp2 C T 2: 133,561,359 R277* probably null Het
Cbl A T 9: 44,154,254 S659T probably damaging Het
Col14a1 A T 15: 55,338,445 H43L unknown Het
Corin A G 5: 72,435,257 C133R probably damaging Het
Cyp1a1 A G 9: 57,702,369 N401S probably benign Het
Dip2a T C 10: 76,296,393 D508G probably damaging Het
Dnah2 T A 11: 69,457,993 H2556L probably benign Het
Dock8 T C 19: 25,163,094 F1333L probably benign Het
Epg5 A G 18: 77,962,445 K717E possibly damaging Het
Fmn2 G A 1: 174,608,880 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hbp1 T C 12: 31,928,618 N510S probably damaging Het
Lrguk T C 6: 34,073,797 S397P possibly damaging Het
Mmrn1 A T 6: 60,976,586 D617V probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
N6amt1 A G 16: 87,354,353 D34G probably damaging Het
Nktr A T 9: 121,727,346 D30V probably damaging Het
Olfr1151 A T 2: 87,857,696 I174F probably damaging Het
Olfr598 T A 7: 103,329,050 M188K probably damaging Het
Olfr805 T A 10: 129,722,945 I200L probably benign Het
Pabpc1 A G 15: 36,600,625 F314L probably damaging Het
Papln G A 12: 83,774,571 V226M probably damaging Het
Parp12 A T 6: 39,102,612 D321E probably damaging Het
Plch2 T A 4: 154,984,534 T1107S probably benign Het
Psma2 T C 13: 14,625,217 L182P probably damaging Het
Rcl1 A G 19: 29,128,001 Y196C probably benign Het
Rdh16 G A 10: 127,801,267 V24M probably damaging Het
Rpe65 A G 3: 159,604,404 T105A possibly damaging Het
Serpini1 T C 3: 75,640,294 I371T probably damaging Het
Tet2 T C 3: 133,485,913 N920S probably benign Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tmprss11f T A 5: 86,556,978 D27V possibly damaging Het
Other mutations in Zxdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01468:Zxdc APN 6 90373779 missense probably damaging 1.00
IGL01943:Zxdc APN 6 90372538 intron probably benign
IGL02406:Zxdc APN 6 90398836 missense probably benign 0.00
IGL02596:Zxdc APN 6 90373709 critical splice acceptor site probably null
IGL02623:Zxdc APN 6 90382370 missense probably damaging 0.99
IGL02927:Zxdc APN 6 90372562 missense probably damaging 1.00
IGL03230:Zxdc APN 6 90373803 missense probably damaging 1.00
PIT4378001:Zxdc UTSW 6 90373716 missense probably damaging 1.00
R0071:Zxdc UTSW 6 90370416 missense probably damaging 1.00
R0194:Zxdc UTSW 6 90372537 intron probably benign
R1065:Zxdc UTSW 6 90378903 missense probably damaging 1.00
R1377:Zxdc UTSW 6 90378903 missense probably damaging 1.00
R1405:Zxdc UTSW 6 90384243 missense possibly damaging 0.50
R1405:Zxdc UTSW 6 90384243 missense possibly damaging 0.50
R1692:Zxdc UTSW 6 90378951 nonsense probably null
R2171:Zxdc UTSW 6 90382479 missense possibly damaging 0.53
R3952:Zxdc UTSW 6 90370467 splice site probably null
R4400:Zxdc UTSW 6 90369810 missense probably damaging 1.00
R4660:Zxdc UTSW 6 90378838 missense probably damaging 0.99
R4776:Zxdc UTSW 6 90370518 missense probably damaging 1.00
R4781:Zxdc UTSW 6 90372553 missense probably damaging 0.98
R4843:Zxdc UTSW 6 90382272 missense probably damaging 1.00
R5028:Zxdc UTSW 6 90382338 missense probably benign 0.44
R5260:Zxdc UTSW 6 90382093 missense probably damaging 1.00
R5279:Zxdc UTSW 6 90370437 missense possibly damaging 0.86
R5363:Zxdc UTSW 6 90382146 missense probably damaging 0.97
R5436:Zxdc UTSW 6 90370560 missense probably damaging 0.99
R5872:Zxdc UTSW 6 90370299 missense probably damaging 0.99
R5940:Zxdc UTSW 6 90370325 missense probably damaging 1.00
R6762:Zxdc UTSW 6 90382183 missense probably benign
R7175:Zxdc UTSW 6 90369663 missense possibly damaging 0.85
R7197:Zxdc UTSW 6 90378837 missense probably damaging 0.99
R7238:Zxdc UTSW 6 90369660 missense unknown
R7247:Zxdc UTSW 6 90384173 missense unknown
R7917:Zxdc UTSW 6 90382009 missense probably damaging 1.00
R7976:Zxdc UTSW 6 90398767 missense probably benign 0.05
R8792:Zxdc UTSW 6 90370004 missense probably benign 0.00
R8917:Zxdc UTSW 6 90382323 missense probably benign 0.00
R9016:Zxdc UTSW 6 90382272 missense probably damaging 1.00
R9076:Zxdc UTSW 6 90372839 missense probably damaging 1.00
R9190:Zxdc UTSW 6 90398791 missense probably damaging 0.96
R9216:Zxdc UTSW 6 90382207 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AGGGATACACTGTTTCAGGTC -3'
(R):5'- AGCCACAGACTGAATGCTTC -3'

Sequencing Primer
(F):5'- AGGTCTAAAGTCTCATGCCTG -3'
(R):5'- AGCCACAGACTGAATGCTTCTTCTAG -3'
Posted On 2016-07-22