Incidental Mutation 'R5324:Olfr598'
ID405018
Institutional Source Beutler Lab
Gene Symbol Olfr598
Ensembl Gene ENSMUSG00000073951
Gene Nameolfactory receptor 598
SynonymsGA_x6K02T2PBJ9-6037823-6038782, MOR23-4P, MOR23-5
MMRRC Submission 042907-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R5324 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103323568-103329888 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103329050 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 188 (M188K)
Ref Sequence ENSEMBL: ENSMUSP00000149199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098202] [ENSMUST00000214765]
Predicted Effect probably damaging
Transcript: ENSMUST00000098202
AA Change: M188K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100474
Gene: ENSMUSG00000073951
AA Change: M188K

DomainStartEndE-ValueType
Pfam:7tm_4 37 315 2.3e-89 PFAM
Pfam:7TM_GPCR_Srsx 41 312 9e-7 PFAM
Pfam:7tm_1 47 297 2e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214765
AA Change: M188K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,907 probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ap5b1 G A 19: 5,569,835 E428K possibly damaging Het
Bmp2 C T 2: 133,561,359 R277* probably null Het
Cbl A T 9: 44,154,254 S659T probably damaging Het
Col14a1 A T 15: 55,338,445 H43L unknown Het
Corin A G 5: 72,435,257 C133R probably damaging Het
Cyp1a1 A G 9: 57,702,369 N401S probably benign Het
Dip2a T C 10: 76,296,393 D508G probably damaging Het
Dnah2 T A 11: 69,457,993 H2556L probably benign Het
Dock8 T C 19: 25,163,094 F1333L probably benign Het
Epg5 A G 18: 77,962,445 K717E possibly damaging Het
Fmn2 G A 1: 174,608,880 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hbp1 T C 12: 31,928,618 N510S probably damaging Het
Lrguk T C 6: 34,073,797 S397P possibly damaging Het
Mmrn1 A T 6: 60,976,586 D617V probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
N6amt1 A G 16: 87,354,353 D34G probably damaging Het
Nktr A T 9: 121,727,346 D30V probably damaging Het
Olfr1151 A T 2: 87,857,696 I174F probably damaging Het
Olfr805 T A 10: 129,722,945 I200L probably benign Het
Pabpc1 A G 15: 36,600,625 F314L probably damaging Het
Papln G A 12: 83,774,571 V226M probably damaging Het
Parp12 A T 6: 39,102,612 D321E probably damaging Het
Plch2 T A 4: 154,984,534 T1107S probably benign Het
Psma2 T C 13: 14,625,217 L182P probably damaging Het
Rcl1 A G 19: 29,128,001 Y196C probably benign Het
Rdh16 G A 10: 127,801,267 V24M probably damaging Het
Rpe65 A G 3: 159,604,404 T105A possibly damaging Het
Serpini1 T C 3: 75,640,294 I371T probably damaging Het
Tet2 T C 3: 133,485,913 N920S probably benign Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tmprss11f T A 5: 86,556,978 D27V possibly damaging Het
Zxdc T A 6: 90,373,800 I411N probably damaging Het
Other mutations in Olfr598
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Olfr598 APN 7 103329321 missense probably damaging 1.00
IGL01911:Olfr598 APN 7 103329273 missense probably benign 0.30
IGL02225:Olfr598 APN 7 103329166 missense probably damaging 1.00
IGL02687:Olfr598 APN 7 103329400 nonsense probably null
IGL03214:Olfr598 APN 7 103328666 missense possibly damaging 0.95
R0544:Olfr598 UTSW 7 103328651 missense probably damaging 1.00
R0555:Olfr598 UTSW 7 103328963 missense probably benign
R1081:Olfr598 UTSW 7 103329038 missense probably damaging 1.00
R1802:Olfr598 UTSW 7 103328647 missense probably benign 0.09
R2092:Olfr598 UTSW 7 103329109 missense probably damaging 1.00
R2197:Olfr598 UTSW 7 103328624 nonsense probably null
R3974:Olfr598 UTSW 7 103329078 missense probably damaging 0.98
R4227:Olfr598 UTSW 7 103328819 missense probably damaging 0.97
R4809:Olfr598 UTSW 7 103328523 nonsense probably null
R4977:Olfr598 UTSW 7 103328833 missense probably benign 0.00
R5478:Olfr598 UTSW 7 103328825 missense probably damaging 1.00
R6238:Olfr598 UTSW 7 103328908 missense possibly damaging 0.95
R6797:Olfr598 UTSW 7 103329121 missense probably benign
R7062:Olfr598 UTSW 7 103329086 missense probably benign 0.10
R7079:Olfr598 UTSW 7 103329184 missense probably benign 0.00
R7539:Olfr598 UTSW 7 103328494 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGGCATTCTGTTGGCAATGG -3'
(R):5'- AATATGAGCTGTGCAGGTGTTAAAG -3'

Sequencing Primer
(F):5'- CGATACATTGCAATCTGTGATCC -3'
(R):5'- CAGGTGTTAAAGGCTTTGAGC -3'
Posted On2016-07-22