Incidental Mutation 'R5324:9130019O22Rik'
ID 405020
Institutional Source Beutler Lab
Gene Symbol 9130019O22Rik
Ensembl Gene ENSMUSG00000030823
Gene Name RIKEN cDNA 9130019O22 gene
Synonyms
MMRRC Submission 042907-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock # R5324 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 127382260-127387166 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) G to T at 127384907 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049052] [ENSMUST00000164345] [ENSMUST00000165495]
AlphaFold G3X941
Predicted Effect unknown
Transcript: ENSMUST00000049052
AA Change: S341Y
SMART Domains Protein: ENSMUSP00000038195
Gene: ENSMUSG00000030823
AA Change: S341Y

DomainStartEndE-ValueType
KRAB 22 82 5.44e-25 SMART
low complexity region 102 115 N/A INTRINSIC
ZnF_C2H2 152 174 6.88e-4 SMART
ZnF_C2H2 180 202 1.47e-3 SMART
ZnF_C2H2 208 230 5.29e-5 SMART
ZnF_C2H2 236 258 4.87e-4 SMART
ZnF_C2H2 264 286 3.69e-4 SMART
ZnF_C2H2 292 314 1.47e-3 SMART
ZnF_C2H2 320 342 5.21e-4 SMART
ZnF_C2H2 348 370 1.45e-2 SMART
ZnF_C2H2 376 398 2.12e-4 SMART
ZnF_C2H2 404 427 1.45e-2 SMART
ZnF_C2H2 433 455 3.69e-4 SMART
ZnF_C2H2 461 483 6.67e-2 SMART
ZnF_C2H2 489 511 1.67e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164345
SMART Domains Protein: ENSMUSP00000131610
Gene: ENSMUSG00000030823

DomainStartEndE-ValueType
KRAB 22 67 1.65e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165495
SMART Domains Protein: ENSMUSP00000126288
Gene: ENSMUSG00000078580

DomainStartEndE-ValueType
KRAB 22 82 4.09e-29 SMART
ZnF_C2H2 168 190 2.2e-2 SMART
ZnF_C2H2 196 218 4.79e-3 SMART
ZnF_C2H2 224 246 4.3e-5 SMART
ZnF_C2H2 252 274 7.9e-4 SMART
ZnF_C2H2 280 302 9.58e-3 SMART
ZnF_C2H2 308 331 2.36e-2 SMART
ZnF_C2H2 337 359 2.57e-3 SMART
ZnF_C2H2 365 387 1.69e-3 SMART
ZnF_C2H2 393 415 2.2e-2 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ap5b1 G A 19: 5,569,835 E428K possibly damaging Het
Bmp2 C T 2: 133,561,359 R277* probably null Het
Cbl A T 9: 44,154,254 S659T probably damaging Het
Col14a1 A T 15: 55,338,445 H43L unknown Het
Corin A G 5: 72,435,257 C133R probably damaging Het
Cyp1a1 A G 9: 57,702,369 N401S probably benign Het
Dip2a T C 10: 76,296,393 D508G probably damaging Het
Dnah2 T A 11: 69,457,993 H2556L probably benign Het
Dock8 T C 19: 25,163,094 F1333L probably benign Het
Epg5 A G 18: 77,962,445 K717E possibly damaging Het
Fmn2 G A 1: 174,608,880 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hbp1 T C 12: 31,928,618 N510S probably damaging Het
Lrguk T C 6: 34,073,797 S397P possibly damaging Het
Mmrn1 A T 6: 60,976,586 D617V probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
N6amt1 A G 16: 87,354,353 D34G probably damaging Het
Nktr A T 9: 121,727,346 D30V probably damaging Het
Olfr1151 A T 2: 87,857,696 I174F probably damaging Het
Olfr598 T A 7: 103,329,050 M188K probably damaging Het
Olfr805 T A 10: 129,722,945 I200L probably benign Het
Pabpc1 A G 15: 36,600,625 F314L probably damaging Het
Papln G A 12: 83,774,571 V226M probably damaging Het
Parp12 A T 6: 39,102,612 D321E probably damaging Het
Plch2 T A 4: 154,984,534 T1107S probably benign Het
Psma2 T C 13: 14,625,217 L182P probably damaging Het
Rcl1 A G 19: 29,128,001 Y196C probably benign Het
Rdh16 G A 10: 127,801,267 V24M probably damaging Het
Rpe65 A G 3: 159,604,404 T105A possibly damaging Het
Serpini1 T C 3: 75,640,294 I371T probably damaging Het
Tet2 T C 3: 133,485,913 N920S probably benign Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tmprss11f T A 5: 86,556,978 D27V possibly damaging Het
Zxdc T A 6: 90,373,800 I411N probably damaging Het
Other mutations in 9130019O22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:9130019O22Rik APN 7 127386544 unclassified probably benign
IGL03102:9130019O22Rik APN 7 127384779 missense probably benign 0.01
IGL03264:9130019O22Rik APN 7 127385639 unclassified probably benign
R1653:9130019O22Rik UTSW 7 127384480 missense possibly damaging 0.71
R1692:9130019O22Rik UTSW 7 127384480 missense possibly damaging 0.71
R2042:9130019O22Rik UTSW 7 127385469 missense possibly damaging 0.93
R2132:9130019O22Rik UTSW 7 127386935 missense probably benign
R3768:9130019O22Rik UTSW 7 127384863 unclassified probably benign
R3769:9130019O22Rik UTSW 7 127384863 unclassified probably benign
R3770:9130019O22Rik UTSW 7 127384863 unclassified probably benign
R4459:9130019O22Rik UTSW 7 127384745 missense probably damaging 0.98
R4461:9130019O22Rik UTSW 7 127384745 missense probably damaging 0.98
R4839:9130019O22Rik UTSW 7 127385007 missense probably benign 0.32
R4903:9130019O22Rik UTSW 7 127385406 missense probably benign 0.02
R5231:9130019O22Rik UTSW 7 127385414 missense probably damaging 0.98
R5735:9130019O22Rik UTSW 7 127385407 missense possibly damaging 0.60
R5808:9130019O22Rik UTSW 7 127384913 unclassified probably benign
R6429:9130019O22Rik UTSW 7 127385042 unclassified probably benign
R6571:9130019O22Rik UTSW 7 127385138 unclassified probably benign
R6655:9130019O22Rik UTSW 7 127384340 missense possibly damaging 0.96
R6806:9130019O22Rik UTSW 7 127386594 unclassified probably benign
R6962:9130019O22Rik UTSW 7 127384315 missense possibly damaging 0.70
R7091:9130019O22Rik UTSW 7 127384362 missense possibly damaging 0.70
R7204:9130019O22Rik UTSW 7 127384346 missense possibly damaging 0.92
R7218:9130019O22Rik UTSW 7 127384680 missense probably benign 0.32
R7570:9130019O22Rik UTSW 7 127385283 missense probably benign 0.00
R7604:9130019O22Rik UTSW 7 127386535 missense unknown
R7661:9130019O22Rik UTSW 7 127384963 nonsense probably null
R7893:9130019O22Rik UTSW 7 127386544 unclassified probably benign
R8323:9130019O22Rik UTSW 7 127384449 missense possibly damaging 0.71
R9172:9130019O22Rik UTSW 7 127385454 missense probably benign 0.38
R9204:9130019O22Rik UTSW 7 127385160 missense unknown
Predicted Primers PCR Primer
(F):5'- TGAAGCAGCGTCCACAATC -3'
(R):5'- TGGCACACATGTACTCTCAC -3'

Sequencing Primer
(F):5'- AGTAAGGCTTCTCCCCAGTGTG -3'
(R):5'- CACAGGTGAAAAGCCGTTTC -3'
Posted On 2016-07-22