Incidental Mutation 'R5324:Cyp1a1'
ID 405022
Institutional Source Beutler Lab
Gene Symbol Cyp1a1
Ensembl Gene ENSMUSG00000032315
Gene Name cytochrome P450, family 1, subfamily a, polypeptide 1
Synonyms P450-1, cytochrome P450 subfamily I, polypeptide 1
MMRRC Submission 042907-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R5324 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 57687928-57703824 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 57702369 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 401 (N401S)
Ref Sequence ENSEMBL: ENSMUSP00000150277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034865] [ENSMUST00000216433]
AlphaFold P00184
Predicted Effect probably benign
Transcript: ENSMUST00000034865
AA Change: N401S

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000034865
Gene: ENSMUSG00000032315
AA Change: N401S

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:p450 44 509 2.3e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216433
AA Change: N401S

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, CYP1A1, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by some polycyclic aromatic hydrocarbons (PAHs), some of which are found in cigarette smoke. The enzyme's endogenous substrate is unknown; however, it is able to metabolize some PAHs to carcinogenic intermediates. The gene has been associated with lung cancer risk. A related family member, CYP1A2, is located approximately 25 kb away from CYP1A1 on chromosome 15. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele display resitance to some signs of TCDD induced toxicity but do not display any gross abnormalities in the abscence of treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,907 probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ap5b1 G A 19: 5,569,835 E428K possibly damaging Het
Bmp2 C T 2: 133,561,359 R277* probably null Het
Cbl A T 9: 44,154,254 S659T probably damaging Het
Col14a1 A T 15: 55,338,445 H43L unknown Het
Corin A G 5: 72,435,257 C133R probably damaging Het
Dip2a T C 10: 76,296,393 D508G probably damaging Het
Dnah2 T A 11: 69,457,993 H2556L probably benign Het
Dock8 T C 19: 25,163,094 F1333L probably benign Het
Epg5 A G 18: 77,962,445 K717E possibly damaging Het
Fmn2 G A 1: 174,608,880 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hbp1 T C 12: 31,928,618 N510S probably damaging Het
Lrguk T C 6: 34,073,797 S397P possibly damaging Het
Mmrn1 A T 6: 60,976,586 D617V probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
N6amt1 A G 16: 87,354,353 D34G probably damaging Het
Nktr A T 9: 121,727,346 D30V probably damaging Het
Olfr1151 A T 2: 87,857,696 I174F probably damaging Het
Olfr598 T A 7: 103,329,050 M188K probably damaging Het
Olfr805 T A 10: 129,722,945 I200L probably benign Het
Pabpc1 A G 15: 36,600,625 F314L probably damaging Het
Papln G A 12: 83,774,571 V226M probably damaging Het
Parp12 A T 6: 39,102,612 D321E probably damaging Het
Plch2 T A 4: 154,984,534 T1107S probably benign Het
Psma2 T C 13: 14,625,217 L182P probably damaging Het
Rcl1 A G 19: 29,128,001 Y196C probably benign Het
Rdh16 G A 10: 127,801,267 V24M probably damaging Het
Rpe65 A G 3: 159,604,404 T105A possibly damaging Het
Serpini1 T C 3: 75,640,294 I371T probably damaging Het
Tet2 T C 3: 133,485,913 N920S probably benign Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tmprss11f T A 5: 86,556,978 D27V possibly damaging Het
Zxdc T A 6: 90,373,800 I411N probably damaging Het
Other mutations in Cyp1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Cyp1a1 APN 9 57700707 missense probably damaging 1.00
IGL02427:Cyp1a1 APN 9 57700575 missense probably damaging 1.00
IGL02952:Cyp1a1 APN 9 57702710 missense probably benign
IGL03002:Cyp1a1 APN 9 57702441 splice site probably benign
IGL03085:Cyp1a1 APN 9 57701712 missense possibly damaging 0.89
PIT1430001:Cyp1a1 UTSW 9 57700911 missense probably benign 0.27
R0508:Cyp1a1 UTSW 9 57700305 missense probably benign
R1844:Cyp1a1 UTSW 9 57702697 missense probably benign
R2216:Cyp1a1 UTSW 9 57702069 splice site probably null
R2394:Cyp1a1 UTSW 9 57700149 missense probably benign 0.13
R3966:Cyp1a1 UTSW 9 57700149 missense probably benign 0.13
R4056:Cyp1a1 UTSW 9 57700149 missense probably benign 0.13
R4367:Cyp1a1 UTSW 9 57700149 missense probably benign
R4529:Cyp1a1 UTSW 9 57701679 missense probably benign 0.01
R4616:Cyp1a1 UTSW 9 57701756 missense probably benign 0.09
R4656:Cyp1a1 UTSW 9 57702610 missense probably damaging 0.99
R5271:Cyp1a1 UTSW 9 57702838 missense probably benign 0.01
R6113:Cyp1a1 UTSW 9 57701891 missense probably damaging 1.00
R6189:Cyp1a1 UTSW 9 57700683 missense probably damaging 1.00
R6239:Cyp1a1 UTSW 9 57702078 missense probably benign 0.36
R6382:Cyp1a1 UTSW 9 57700690 missense probably damaging 0.99
R6750:Cyp1a1 UTSW 9 57700256 missense probably benign
R6869:Cyp1a1 UTSW 9 57702784 missense probably benign
R6881:Cyp1a1 UTSW 9 57700719 missense possibly damaging 0.78
R6913:Cyp1a1 UTSW 9 57700293 missense probably damaging 0.98
R7341:Cyp1a1 UTSW 9 57700824 missense probably damaging 0.99
R7450:Cyp1a1 UTSW 9 57702132 missense probably damaging 0.99
R7938:Cyp1a1 UTSW 9 57701790 missense probably damaging 1.00
R8171:Cyp1a1 UTSW 9 57700196 missense probably benign
R8322:Cyp1a1 UTSW 9 57702720 missense probably damaging 0.97
R9025:Cyp1a1 UTSW 9 57702787 missense possibly damaging 0.55
R9215:Cyp1a1 UTSW 9 57702173 missense probably benign 0.00
R9599:Cyp1a1 UTSW 9 57700487 missense probably benign 0.26
Z1176:Cyp1a1 UTSW 9 57700594 missense probably benign 0.15
Z1177:Cyp1a1 UTSW 9 57700514 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCAGACCATAGATCCGTTGAC -3'
(R):5'- AACCTTTCAGGCCGGAACTC -3'

Sequencing Primer
(F):5'- CAGACCATAGATCCGTTGACATTTG -3'
(R):5'- CACAGTTCCCTATATGCAGAGG -3'
Posted On 2016-07-22