Incidental Mutation 'R5324:Nktr'
ID 405023
Institutional Source Beutler Lab
Gene Symbol Nktr
Ensembl Gene ENSMUSG00000032525
Gene Name natural killer tumor recognition sequence
Synonyms D9Wsu172e, 5330401F18Rik
MMRRC Submission 042907-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.620) question?
Stock # R5324 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 121548235-121585909 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 121556412 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 30 (D30V)
Ref Sequence ENSEMBL: ENSMUSP00000138168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035112] [ENSMUST00000182179] [ENSMUST00000182225] [ENSMUST00000182311] [ENSMUST00000182337] [ENSMUST00000182763] [ENSMUST00000183070]
AlphaFold P30415
Predicted Effect probably damaging
Transcript: ENSMUST00000035112
AA Change: D30V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035112
Gene: ENSMUSG00000032525
AA Change: D30V

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 175 1.7e-48 PFAM
low complexity region 195 229 N/A INTRINSIC
low complexity region 277 294 N/A INTRINSIC
low complexity region 346 360 N/A INTRINSIC
low complexity region 427 459 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
low complexity region 509 565 N/A INTRINSIC
low complexity region 677 726 N/A INTRINSIC
low complexity region 736 749 N/A INTRINSIC
low complexity region 797 812 N/A INTRINSIC
low complexity region 900 914 N/A INTRINSIC
low complexity region 921 929 N/A INTRINSIC
low complexity region 948 958 N/A INTRINSIC
low complexity region 983 1003 N/A INTRINSIC
low complexity region 1189 1200 N/A INTRINSIC
low complexity region 1229 1236 N/A INTRINSIC
low complexity region 1316 1453 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182086
Predicted Effect probably damaging
Transcript: ENSMUST00000182179
AA Change: D30V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138437
Gene: ENSMUSG00000032525
AA Change: D30V

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 103 1.9e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182225
AA Change: D30V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138168
Gene: ENSMUSG00000032525
AA Change: D30V

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 175 2.1e-47 PFAM
low complexity region 184 215 N/A INTRINSIC
low complexity region 252 269 N/A INTRINSIC
low complexity region 321 335 N/A INTRINSIC
low complexity region 402 434 N/A INTRINSIC
low complexity region 452 478 N/A INTRINSIC
low complexity region 484 540 N/A INTRINSIC
low complexity region 652 701 N/A INTRINSIC
low complexity region 711 724 N/A INTRINSIC
low complexity region 772 787 N/A INTRINSIC
low complexity region 875 889 N/A INTRINSIC
low complexity region 896 904 N/A INTRINSIC
low complexity region 923 933 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182311
AA Change: D30V

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138690
Gene: ENSMUSG00000032525
AA Change: D30V

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 54 2.9e-8 PFAM
Pfam:Pro_isomerase 44 99 7.1e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182337
AA Change: D23V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138164
Gene: ENSMUSG00000032525
AA Change: D23V

DomainStartEndE-ValueType
Pfam:Pro_isomerase 7 101 1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182395
Predicted Effect probably damaging
Transcript: ENSMUST00000182763
AA Change: D30V

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138272
Gene: ENSMUSG00000032525
AA Change: D30V

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 68 3.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182904
Predicted Effect probably damaging
Transcript: ENSMUST00000183070
AA Change: D30V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138611
Gene: ENSMUSG00000032525
AA Change: D30V

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 103 1.9e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183311
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-anchored protein with a hydrophobic amino terminal domain and a cyclophilin-like PPIase domain. It is present on the surface of natural killer cells and facilitates their binding to targets. Its expression is regulated by IL2 activation of the cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap10 C T 11: 61,807,015 (GRCm39) A72T probably damaging Het
Ap5b1 G A 19: 5,619,863 (GRCm39) E428K possibly damaging Het
Bmp2 C T 2: 133,403,279 (GRCm39) R277* probably null Het
Cbl A T 9: 44,065,551 (GRCm39) S659T probably damaging Het
Col14a1 A T 15: 55,201,841 (GRCm39) H43L unknown Het
Corin A G 5: 72,592,600 (GRCm39) C133R probably damaging Het
Cyp1a1 A G 9: 57,609,652 (GRCm39) N401S probably benign Het
Dip2a T C 10: 76,132,227 (GRCm39) D508G probably damaging Het
Dnah2 T A 11: 69,348,819 (GRCm39) H2556L probably benign Het
Dock8 T C 19: 25,140,458 (GRCm39) F1333L probably benign Het
Epg5 A G 18: 78,005,660 (GRCm39) K717E possibly damaging Het
Fmn2 G A 1: 174,436,446 (GRCm39) probably benign Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Hbp1 T C 12: 31,978,617 (GRCm39) N510S probably damaging Het
Lrguk T C 6: 34,050,732 (GRCm39) S397P possibly damaging Het
Mmrn1 A T 6: 60,953,570 (GRCm39) D617V probably damaging Het
Mroh9 C G 1: 162,888,329 (GRCm39) G249R probably damaging Het
N6amt1 A G 16: 87,151,241 (GRCm39) D34G probably damaging Het
Or52ab7 T A 7: 102,978,257 (GRCm39) M188K probably damaging Het
Or5w8 A T 2: 87,688,040 (GRCm39) I174F probably damaging Het
Or6c212 T A 10: 129,558,814 (GRCm39) I200L probably benign Het
Pabpc1 A G 15: 36,600,869 (GRCm39) F314L probably damaging Het
Papln G A 12: 83,821,345 (GRCm39) V226M probably damaging Het
Parp12 A T 6: 39,079,546 (GRCm39) D321E probably damaging Het
Plch2 T A 4: 155,068,991 (GRCm39) T1107S probably benign Het
Psma2 T C 13: 14,799,802 (GRCm39) L182P probably damaging Het
Rcl1 A G 19: 29,105,401 (GRCm39) Y196C probably benign Het
Rdh16 G A 10: 127,637,136 (GRCm39) V24M probably damaging Het
Rpe65 A G 3: 159,310,041 (GRCm39) T105A possibly damaging Het
Serpini1 T C 3: 75,547,601 (GRCm39) I371T probably damaging Het
Tet2 T C 3: 133,191,674 (GRCm39) N920S probably benign Het
Tmem71 C T 15: 66,427,063 (GRCm39) S44N probably benign Het
Tmprss11f T A 5: 86,704,837 (GRCm39) D27V possibly damaging Het
Zfp747l1 G T 7: 126,984,079 (GRCm39) probably benign Het
Zxdc T A 6: 90,350,782 (GRCm39) I411N probably damaging Het
Other mutations in Nktr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Nktr APN 9 121,560,630 (GRCm39) missense possibly damaging 0.94
IGL01402:Nktr APN 9 121,570,218 (GRCm39) splice site probably null
IGL01404:Nktr APN 9 121,570,218 (GRCm39) splice site probably null
IGL02945:Nktr APN 9 121,557,697 (GRCm39) missense probably damaging 1.00
IGL03334:Nktr APN 9 121,577,242 (GRCm39) missense probably benign 0.18
IGL03134:Nktr UTSW 9 121,575,532 (GRCm39) missense probably damaging 1.00
PIT4131001:Nktr UTSW 9 121,570,687 (GRCm39) missense probably damaging 1.00
R0010:Nktr UTSW 9 121,570,232 (GRCm39) splice site probably benign
R0158:Nktr UTSW 9 121,579,757 (GRCm39) unclassified probably benign
R0399:Nktr UTSW 9 121,560,550 (GRCm39) missense probably damaging 0.98
R0503:Nktr UTSW 9 121,579,806 (GRCm39) unclassified probably benign
R0585:Nktr UTSW 9 121,583,346 (GRCm39) utr 3 prime probably benign
R0606:Nktr UTSW 9 121,578,356 (GRCm39) unclassified probably benign
R1248:Nktr UTSW 9 121,556,436 (GRCm39) missense probably damaging 1.00
R1899:Nktr UTSW 9 121,577,932 (GRCm39) unclassified probably benign
R1912:Nktr UTSW 9 121,579,306 (GRCm39) unclassified probably benign
R2049:Nktr UTSW 9 121,570,760 (GRCm39) missense probably damaging 1.00
R2279:Nktr UTSW 9 121,560,603 (GRCm39) missense possibly damaging 0.93
R2912:Nktr UTSW 9 121,578,670 (GRCm39) unclassified probably benign
R2913:Nktr UTSW 9 121,578,670 (GRCm39) unclassified probably benign
R2914:Nktr UTSW 9 121,578,670 (GRCm39) unclassified probably benign
R3939:Nktr UTSW 9 121,578,135 (GRCm39) unclassified probably benign
R4080:Nktr UTSW 9 121,570,192 (GRCm39) missense probably damaging 1.00
R4471:Nktr UTSW 9 121,577,962 (GRCm39) unclassified probably benign
R4472:Nktr UTSW 9 121,577,962 (GRCm39) unclassified probably benign
R4506:Nktr UTSW 9 121,577,949 (GRCm39) unclassified probably benign
R4556:Nktr UTSW 9 121,570,189 (GRCm39) missense probably damaging 0.98
R4736:Nktr UTSW 9 121,578,805 (GRCm39) unclassified probably benign
R4749:Nktr UTSW 9 121,570,759 (GRCm39) missense probably damaging 1.00
R4943:Nktr UTSW 9 121,549,020 (GRCm39) intron probably benign
R5084:Nktr UTSW 9 121,577,176 (GRCm39) missense possibly damaging 0.86
R5250:Nktr UTSW 9 121,578,858 (GRCm39) unclassified probably benign
R5288:Nktr UTSW 9 121,577,659 (GRCm39) missense probably benign 0.23
R5330:Nktr UTSW 9 121,581,834 (GRCm39) intron probably benign
R5331:Nktr UTSW 9 121,581,834 (GRCm39) intron probably benign
R5502:Nktr UTSW 9 121,577,672 (GRCm39) unclassified probably benign
R5587:Nktr UTSW 9 121,577,555 (GRCm39) unclassified probably benign
R5664:Nktr UTSW 9 121,578,483 (GRCm39) nonsense probably null
R6005:Nktr UTSW 9 121,577,460 (GRCm39) unclassified probably benign
R6057:Nktr UTSW 9 121,577,455 (GRCm39) unclassified probably benign
R6083:Nktr UTSW 9 121,579,202 (GRCm39) unclassified probably benign
R6274:Nktr UTSW 9 121,560,631 (GRCm39) missense probably damaging 1.00
R6445:Nktr UTSW 9 121,577,480 (GRCm39) unclassified probably benign
R6467:Nktr UTSW 9 121,560,585 (GRCm39) missense probably damaging 1.00
R6911:Nktr UTSW 9 121,583,392 (GRCm39) nonsense probably null
R6960:Nktr UTSW 9 121,571,758 (GRCm39) missense probably damaging 0.99
R7226:Nktr UTSW 9 121,575,599 (GRCm39) missense probably damaging 0.99
R7324:Nktr UTSW 9 121,577,357 (GRCm39) missense possibly damaging 0.66
R7324:Nktr UTSW 9 121,556,427 (GRCm39) missense probably damaging 1.00
R7451:Nktr UTSW 9 121,558,722 (GRCm39) missense probably damaging 0.99
R7464:Nktr UTSW 9 121,579,393 (GRCm39) missense unknown
R7537:Nktr UTSW 9 121,578,345 (GRCm39) missense unknown
R8126:Nktr UTSW 9 121,575,514 (GRCm39) missense probably damaging 1.00
R8163:Nktr UTSW 9 121,579,929 (GRCm39) unclassified probably benign
R8812:Nktr UTSW 9 121,579,317 (GRCm39) missense unknown
R8829:Nktr UTSW 9 121,583,330 (GRCm39) missense unknown
R8945:Nktr UTSW 9 121,575,558 (GRCm39) missense possibly damaging 0.70
R9158:Nktr UTSW 9 121,582,154 (GRCm39) missense unknown
R9252:Nktr UTSW 9 121,579,415 (GRCm39) missense unknown
R9378:Nktr UTSW 9 121,577,264 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGATTGATCTCCAGTACTGTA -3'
(R):5'- TGTCCTCTTTTAAGAAATGTTTCCTT -3'

Sequencing Primer
(F):5'- CATACTGTTGTTGGGTACCT -3'
(R):5'- ACAGTTATATCAGGGTCCTGTCAGC -3'
Posted On 2016-07-22