Incidental Mutation 'R5324:Dip2a'
ID 405024
Institutional Source Beutler Lab
Gene Symbol Dip2a
Ensembl Gene ENSMUSG00000020231
Gene Name disco interacting protein 2 homolog A
Synonyms Dip2, Kiaa0184-hp, 4931420H10Rik
MMRRC Submission 042907-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5324 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 76098581-76181194 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 76132227 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 508 (D508G)
Ref Sequence ENSEMBL: ENSMUSP00000125184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036033] [ENSMUST00000105417] [ENSMUST00000160048] [ENSMUST00000160442]
AlphaFold Q8BWT5
Predicted Effect probably damaging
Transcript: ENSMUST00000036033
AA Change: D547G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043710
Gene: ENSMUSG00000020231
AA Change: D547G

DomainStartEndE-ValueType
DMAP_binding 9 122 2.55e-35 SMART
low complexity region 173 208 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
Pfam:AMP-binding 330 806 4.3e-26 PFAM
Pfam:AMP-binding 982 1456 1.4e-52 PFAM
low complexity region 1487 1498 N/A INTRINSIC
low complexity region 1511 1532 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105417
AA Change: D547G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101057
Gene: ENSMUSG00000020231
AA Change: D547G

DomainStartEndE-ValueType
DMAP_binding 9 122 2.55e-35 SMART
low complexity region 173 208 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
Pfam:AMP-binding 330 806 6.6e-28 PFAM
Pfam:AMP-binding 992 1466 7.3e-65 PFAM
low complexity region 1497 1508 N/A INTRINSIC
low complexity region 1521 1542 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160048
AA Change: D508G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125184
Gene: ENSMUSG00000020231
AA Change: D508G

DomainStartEndE-ValueType
DMAP_binding 9 83 7.94e-23 SMART
low complexity region 134 169 N/A INTRINSIC
low complexity region 242 254 N/A INTRINSIC
Pfam:AMP-binding 291 767 5.3e-26 PFAM
Pfam:AMP-binding 943 1417 1.7e-52 PFAM
low complexity region 1448 1459 N/A INTRINSIC
low complexity region 1472 1493 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160442
SMART Domains Protein: ENSMUSP00000125744
Gene: ENSMUSG00000020231

DomainStartEndE-ValueType
low complexity region 37 48 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162766
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may be involved in axon patterning in the central nervous system. This gene is not highly expressed. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap10 C T 11: 61,807,015 (GRCm39) A72T probably damaging Het
Ap5b1 G A 19: 5,619,863 (GRCm39) E428K possibly damaging Het
Bmp2 C T 2: 133,403,279 (GRCm39) R277* probably null Het
Cbl A T 9: 44,065,551 (GRCm39) S659T probably damaging Het
Col14a1 A T 15: 55,201,841 (GRCm39) H43L unknown Het
Corin A G 5: 72,592,600 (GRCm39) C133R probably damaging Het
Cyp1a1 A G 9: 57,609,652 (GRCm39) N401S probably benign Het
Dnah2 T A 11: 69,348,819 (GRCm39) H2556L probably benign Het
Dock8 T C 19: 25,140,458 (GRCm39) F1333L probably benign Het
Epg5 A G 18: 78,005,660 (GRCm39) K717E possibly damaging Het
Fmn2 G A 1: 174,436,446 (GRCm39) probably benign Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Hbp1 T C 12: 31,978,617 (GRCm39) N510S probably damaging Het
Lrguk T C 6: 34,050,732 (GRCm39) S397P possibly damaging Het
Mmrn1 A T 6: 60,953,570 (GRCm39) D617V probably damaging Het
Mroh9 C G 1: 162,888,329 (GRCm39) G249R probably damaging Het
N6amt1 A G 16: 87,151,241 (GRCm39) D34G probably damaging Het
Nktr A T 9: 121,556,412 (GRCm39) D30V probably damaging Het
Or52ab7 T A 7: 102,978,257 (GRCm39) M188K probably damaging Het
Or5w8 A T 2: 87,688,040 (GRCm39) I174F probably damaging Het
Or6c212 T A 10: 129,558,814 (GRCm39) I200L probably benign Het
Pabpc1 A G 15: 36,600,869 (GRCm39) F314L probably damaging Het
Papln G A 12: 83,821,345 (GRCm39) V226M probably damaging Het
Parp12 A T 6: 39,079,546 (GRCm39) D321E probably damaging Het
Plch2 T A 4: 155,068,991 (GRCm39) T1107S probably benign Het
Psma2 T C 13: 14,799,802 (GRCm39) L182P probably damaging Het
Rcl1 A G 19: 29,105,401 (GRCm39) Y196C probably benign Het
Rdh16 G A 10: 127,637,136 (GRCm39) V24M probably damaging Het
Rpe65 A G 3: 159,310,041 (GRCm39) T105A possibly damaging Het
Serpini1 T C 3: 75,547,601 (GRCm39) I371T probably damaging Het
Tet2 T C 3: 133,191,674 (GRCm39) N920S probably benign Het
Tmem71 C T 15: 66,427,063 (GRCm39) S44N probably benign Het
Tmprss11f T A 5: 86,704,837 (GRCm39) D27V possibly damaging Het
Zfp747l1 G T 7: 126,984,079 (GRCm39) probably benign Het
Zxdc T A 6: 90,350,782 (GRCm39) I411N probably damaging Het
Other mutations in Dip2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Dip2a APN 10 76,149,070 (GRCm39) missense probably benign
IGL00849:Dip2a APN 10 76,128,152 (GRCm39) missense probably damaging 0.99
IGL01685:Dip2a APN 10 76,163,583 (GRCm39) missense probably damaging 1.00
IGL01825:Dip2a APN 10 76,108,514 (GRCm39) nonsense probably null
IGL02343:Dip2a APN 10 76,155,312 (GRCm39) missense probably benign 0.00
IGL02437:Dip2a APN 10 76,134,101 (GRCm39) missense probably benign 0.09
IGL02981:Dip2a APN 10 76,112,255 (GRCm39) missense possibly damaging 0.84
IGL03122:Dip2a APN 10 76,110,880 (GRCm39) missense probably benign 0.00
IGL03261:Dip2a APN 10 76,140,982 (GRCm39) missense possibly damaging 0.80
R0369:Dip2a UTSW 10 76,134,621 (GRCm39) missense probably damaging 1.00
R0522:Dip2a UTSW 10 76,157,365 (GRCm39) missense probably benign 0.03
R0962:Dip2a UTSW 10 76,128,266 (GRCm39) unclassified probably benign
R1164:Dip2a UTSW 10 76,112,231 (GRCm39) missense possibly damaging 0.72
R1309:Dip2a UTSW 10 76,115,610 (GRCm39) missense probably damaging 1.00
R1426:Dip2a UTSW 10 76,115,654 (GRCm39) unclassified probably benign
R1636:Dip2a UTSW 10 76,157,412 (GRCm39) missense probably benign 0.01
R1823:Dip2a UTSW 10 76,114,336 (GRCm39) nonsense probably null
R1830:Dip2a UTSW 10 76,153,797 (GRCm39) missense probably damaging 1.00
R1876:Dip2a UTSW 10 76,153,925 (GRCm39) missense probably damaging 1.00
R2284:Dip2a UTSW 10 76,149,027 (GRCm39) missense probably benign 0.01
R2369:Dip2a UTSW 10 76,149,030 (GRCm39) missense probably benign
R4050:Dip2a UTSW 10 76,114,441 (GRCm39) missense probably damaging 1.00
R4089:Dip2a UTSW 10 76,114,323 (GRCm39) splice site probably null
R4231:Dip2a UTSW 10 76,155,304 (GRCm39) missense probably damaging 1.00
R4715:Dip2a UTSW 10 76,132,240 (GRCm39) missense probably benign 0.34
R4752:Dip2a UTSW 10 76,112,491 (GRCm39) missense probably damaging 1.00
R4846:Dip2a UTSW 10 76,157,327 (GRCm39) missense probably damaging 1.00
R4849:Dip2a UTSW 10 76,130,367 (GRCm39) missense probably damaging 1.00
R4892:Dip2a UTSW 10 76,116,593 (GRCm39) missense probably benign 0.02
R4998:Dip2a UTSW 10 76,155,390 (GRCm39) nonsense probably null
R5068:Dip2a UTSW 10 76,153,877 (GRCm39) missense possibly damaging 0.82
R5141:Dip2a UTSW 10 76,106,287 (GRCm39) missense probably damaging 1.00
R5253:Dip2a UTSW 10 76,135,831 (GRCm39) missense probably damaging 1.00
R5304:Dip2a UTSW 10 76,130,357 (GRCm39) missense possibly damaging 0.67
R5369:Dip2a UTSW 10 76,128,194 (GRCm39) missense probably damaging 1.00
R6272:Dip2a UTSW 10 76,122,241 (GRCm39) makesense probably null
R6884:Dip2a UTSW 10 76,108,366 (GRCm39) critical splice donor site probably null
R7143:Dip2a UTSW 10 76,133,625 (GRCm39) missense probably damaging 1.00
R7247:Dip2a UTSW 10 76,108,366 (GRCm39) critical splice donor site probably null
R7252:Dip2a UTSW 10 76,109,036 (GRCm39) missense not run
R7327:Dip2a UTSW 10 76,108,396 (GRCm39) missense probably benign 0.41
R7334:Dip2a UTSW 10 76,110,080 (GRCm39) missense possibly damaging 0.91
R7349:Dip2a UTSW 10 76,121,426 (GRCm39) missense probably damaging 1.00
R7360:Dip2a UTSW 10 76,114,394 (GRCm39) missense probably damaging 1.00
R7513:Dip2a UTSW 10 76,149,069 (GRCm39) missense probably benign
R7793:Dip2a UTSW 10 76,114,417 (GRCm39) missense probably benign 0.06
R7794:Dip2a UTSW 10 76,112,459 (GRCm39) missense probably damaging 1.00
R7819:Dip2a UTSW 10 76,126,862 (GRCm39) missense probably benign 0.06
R8079:Dip2a UTSW 10 76,123,155 (GRCm39) missense probably benign
R8280:Dip2a UTSW 10 76,100,610 (GRCm39) missense possibly damaging 0.75
R8281:Dip2a UTSW 10 76,112,438 (GRCm39) missense probably damaging 1.00
R8286:Dip2a UTSW 10 76,122,297 (GRCm39) missense probably benign
R8350:Dip2a UTSW 10 76,100,690 (GRCm39) missense probably damaging 1.00
R8450:Dip2a UTSW 10 76,100,690 (GRCm39) missense probably damaging 1.00
R8525:Dip2a UTSW 10 76,110,115 (GRCm39) critical splice acceptor site probably null
R8824:Dip2a UTSW 10 76,114,320 (GRCm39) critical splice donor site probably null
R8897:Dip2a UTSW 10 76,110,098 (GRCm39) missense probably benign 0.22
R9039:Dip2a UTSW 10 76,163,553 (GRCm39) missense probably benign 0.00
R9286:Dip2a UTSW 10 76,138,096 (GRCm39) missense probably benign 0.05
R9504:Dip2a UTSW 10 76,132,189 (GRCm39) missense probably damaging 1.00
R9523:Dip2a UTSW 10 76,112,438 (GRCm39) missense probably damaging 1.00
R9628:Dip2a UTSW 10 76,142,993 (GRCm39) missense probably damaging 0.99
R9732:Dip2a UTSW 10 76,110,077 (GRCm39) missense probably benign 0.11
Z1088:Dip2a UTSW 10 76,121,462 (GRCm39) missense probably benign 0.06
Z1176:Dip2a UTSW 10 76,116,654 (GRCm39) missense probably damaging 0.97
Z1176:Dip2a UTSW 10 76,102,157 (GRCm39) missense possibly damaging 0.94
Z1177:Dip2a UTSW 10 76,132,234 (GRCm39) missense probably damaging 1.00
Z1177:Dip2a UTSW 10 76,102,156 (GRCm39) missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- GCTGAAGCTATGCCCAACAAG -3'
(R):5'- TGTGCTTCCAGTCATCCGAG -3'

Sequencing Primer
(F):5'- GAAGCTATGCCCAACAAGCACAC -3'
(R):5'- GAGCAGATACTTAGCTCCCTG -3'
Posted On 2016-07-22