Incidental Mutation 'R5324:Psma2'
ID 405031
Institutional Source Beutler Lab
Gene Symbol Psma2
Ensembl Gene ENSMUSG00000015671
Gene Name proteasome (prosome, macropain) subunit, alpha type 2
Synonyms Lmpc3
MMRRC Submission 042907-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.391) question?
Stock # R5324 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 14613240-14674236 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 14625217 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 182 (L182P)
Ref Sequence ENSEMBL: ENSMUSP00000129767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170836] [ENSMUST00000178289] [ENSMUST00000221168]
AlphaFold P49722
PDB Structure Mouse constitutive 20S proteasome in complex with PR-957 [X-RAY DIFFRACTION]
Mouse constitutive 20S proteasome [X-RAY DIFFRACTION]
Mouse 20S immunoproteasome in complex with PR-957 [X-RAY DIFFRACTION]
Mouse 20S immunoproteasome [X-RAY DIFFRACTION]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158999
Predicted Effect probably damaging
Transcript: ENSMUST00000170836
AA Change: L182P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129767
Gene: ENSMUSG00000015671
AA Change: L182P

DomainStartEndE-ValueType
Proteasome_A_N 6 28 1.73e-5 SMART
Pfam:Proteasome 29 213 1.2e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178289
SMART Domains Protein: ENSMUSP00000136376
Gene: ENSMUSG00000039182

DomainStartEndE-ValueType
Pfam:DUF1308 37 401 1.1e-121 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000221168
AA Change: L131P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,907 probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ap5b1 G A 19: 5,569,835 E428K possibly damaging Het
Bmp2 C T 2: 133,561,359 R277* probably null Het
Cbl A T 9: 44,154,254 S659T probably damaging Het
Col14a1 A T 15: 55,338,445 H43L unknown Het
Corin A G 5: 72,435,257 C133R probably damaging Het
Cyp1a1 A G 9: 57,702,369 N401S probably benign Het
Dip2a T C 10: 76,296,393 D508G probably damaging Het
Dnah2 T A 11: 69,457,993 H2556L probably benign Het
Dock8 T C 19: 25,163,094 F1333L probably benign Het
Epg5 A G 18: 77,962,445 K717E possibly damaging Het
Fmn2 G A 1: 174,608,880 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hbp1 T C 12: 31,928,618 N510S probably damaging Het
Lrguk T C 6: 34,073,797 S397P possibly damaging Het
Mmrn1 A T 6: 60,976,586 D617V probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
N6amt1 A G 16: 87,354,353 D34G probably damaging Het
Nktr A T 9: 121,727,346 D30V probably damaging Het
Olfr1151 A T 2: 87,857,696 I174F probably damaging Het
Olfr598 T A 7: 103,329,050 M188K probably damaging Het
Olfr805 T A 10: 129,722,945 I200L probably benign Het
Pabpc1 A G 15: 36,600,625 F314L probably damaging Het
Papln G A 12: 83,774,571 V226M probably damaging Het
Parp12 A T 6: 39,102,612 D321E probably damaging Het
Plch2 T A 4: 154,984,534 T1107S probably benign Het
Rcl1 A G 19: 29,128,001 Y196C probably benign Het
Rdh16 G A 10: 127,801,267 V24M probably damaging Het
Rpe65 A G 3: 159,604,404 T105A possibly damaging Het
Serpini1 T C 3: 75,640,294 I371T probably damaging Het
Tet2 T C 3: 133,485,913 N920S probably benign Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tmprss11f T A 5: 86,556,978 D27V possibly damaging Het
Zxdc T A 6: 90,373,800 I411N probably damaging Het
Other mutations in Psma2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01963:Psma2 APN 13 14619363 missense probably damaging 0.98
IGL02001:Psma2 APN 13 14623607 missense possibly damaging 0.90
R1245:Psma2 UTSW 13 14613291 missense probably damaging 1.00
R1801:Psma2 UTSW 13 14623605 missense probably benign 0.00
R3428:Psma2 UTSW 13 14616777 missense probably benign 0.03
R4551:Psma2 UTSW 13 14616845 missense possibly damaging 0.69
R5068:Psma2 UTSW 13 14616028 missense probably benign 0.11
R5069:Psma2 UTSW 13 14616028 missense probably benign 0.11
R5070:Psma2 UTSW 13 14616028 missense probably benign 0.11
R7121:Psma2 UTSW 13 14625230 missense probably benign 0.39
R7853:Psma2 UTSW 13 14625247 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCAAGTGTCACATTATTTGGGG -3'
(R):5'- AAAGCCAGCCTCATTGCAG -3'

Sequencing Primer
(F):5'- CACATTATTTGGGGACAGCAGTC -3'
(R):5'- CATTGCAGATCCCAACTTCTATG -3'
Posted On 2016-07-22