Incidental Mutation 'R5324:Col14a1'
ID 405033
Institutional Source Beutler Lab
Gene Symbol Col14a1
Ensembl Gene ENSMUSG00000022371
Gene Name collagen, type XIV, alpha 1
Synonyms 5730412L22Rik
MMRRC Submission 042907-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5324 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 55171146-55384199 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 55201841 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 43 (H43L)
Ref Sequence ENSEMBL: ENSMUSP00000105850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023053] [ENSMUST00000110217] [ENSMUST00000110221]
AlphaFold Q80X19
Predicted Effect unknown
Transcript: ENSMUST00000023053
AA Change: H43L
SMART Domains Protein: ENSMUSP00000023053
Gene: ENSMUSG00000022371
AA Change: H43L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 818 6.2e-7 SMART
FN3 830 909 1.45e-7 SMART
FN3 920 999 3.59e0 SMART
low complexity region 1010 1022 N/A INTRINSIC
VWA 1031 1211 2.02e-59 SMART
TSPN 1230 1425 1.19e-66 SMART
Pfam:Collagen 1461 1515 2.9e-8 PFAM
Pfam:Collagen 1513 1571 6.3e-9 PFAM
Pfam:Collagen 1555 1615 8.5e-10 PFAM
Pfam:Collagen 1653 1709 7.6e-10 PFAM
Pfam:Collagen 1707 1762 2.6e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000110217
AA Change: H43L
SMART Domains Protein: ENSMUSP00000105846
Gene: ENSMUSG00000022371
AA Change: H43L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 819 5.4e-7 SMART
FN3 831 910 1.45e-7 SMART
FN3 921 1000 3.59e0 SMART
low complexity region 1011 1023 N/A INTRINSIC
VWA 1032 1212 2.02e-59 SMART
TSPN 1231 1426 1.19e-66 SMART
Pfam:Collagen 1462 1516 2.5e-8 PFAM
Pfam:Collagen 1514 1572 5.4e-9 PFAM
Pfam:Collagen 1556 1616 7.3e-10 PFAM
Pfam:Collagen 1654 1710 6.5e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000110221
AA Change: H43L
SMART Domains Protein: ENSMUSP00000105850
Gene: ENSMUSG00000022371
AA Change: H43L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 815 7.12e-7 SMART
FN3 827 906 1.45e-7 SMART
FN3 917 996 3.59e0 SMART
low complexity region 1007 1019 N/A INTRINSIC
VWA 1028 1208 2.02e-59 SMART
TSPN 1227 1422 1.19e-66 SMART
Pfam:Collagen 1458 1512 8.2e-9 PFAM
Pfam:Collagen 1510 1568 1.8e-9 PFAM
Pfam:Collagen 1552 1612 2.4e-10 PFAM
Pfam:Collagen 1650 1706 2.2e-10 PFAM
Pfam:Collagen 1704 1759 7.5e-8 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XIV collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XIV collagen interacts with the fibril surface and is involved in the regulation of fibrillogenesis. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null mutation display abnormal tendon morphology and abnormal biomechanical properties of the skin and tendons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap10 C T 11: 61,807,015 (GRCm39) A72T probably damaging Het
Ap5b1 G A 19: 5,619,863 (GRCm39) E428K possibly damaging Het
Bmp2 C T 2: 133,403,279 (GRCm39) R277* probably null Het
Cbl A T 9: 44,065,551 (GRCm39) S659T probably damaging Het
Corin A G 5: 72,592,600 (GRCm39) C133R probably damaging Het
Cyp1a1 A G 9: 57,609,652 (GRCm39) N401S probably benign Het
Dip2a T C 10: 76,132,227 (GRCm39) D508G probably damaging Het
Dnah2 T A 11: 69,348,819 (GRCm39) H2556L probably benign Het
Dock8 T C 19: 25,140,458 (GRCm39) F1333L probably benign Het
Epg5 A G 18: 78,005,660 (GRCm39) K717E possibly damaging Het
Fmn2 G A 1: 174,436,446 (GRCm39) probably benign Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Hbp1 T C 12: 31,978,617 (GRCm39) N510S probably damaging Het
Lrguk T C 6: 34,050,732 (GRCm39) S397P possibly damaging Het
Mmrn1 A T 6: 60,953,570 (GRCm39) D617V probably damaging Het
Mroh9 C G 1: 162,888,329 (GRCm39) G249R probably damaging Het
N6amt1 A G 16: 87,151,241 (GRCm39) D34G probably damaging Het
Nktr A T 9: 121,556,412 (GRCm39) D30V probably damaging Het
Or52ab7 T A 7: 102,978,257 (GRCm39) M188K probably damaging Het
Or5w8 A T 2: 87,688,040 (GRCm39) I174F probably damaging Het
Or6c212 T A 10: 129,558,814 (GRCm39) I200L probably benign Het
Pabpc1 A G 15: 36,600,869 (GRCm39) F314L probably damaging Het
Papln G A 12: 83,821,345 (GRCm39) V226M probably damaging Het
Parp12 A T 6: 39,079,546 (GRCm39) D321E probably damaging Het
Plch2 T A 4: 155,068,991 (GRCm39) T1107S probably benign Het
Psma2 T C 13: 14,799,802 (GRCm39) L182P probably damaging Het
Rcl1 A G 19: 29,105,401 (GRCm39) Y196C probably benign Het
Rdh16 G A 10: 127,637,136 (GRCm39) V24M probably damaging Het
Rpe65 A G 3: 159,310,041 (GRCm39) T105A possibly damaging Het
Serpini1 T C 3: 75,547,601 (GRCm39) I371T probably damaging Het
Tet2 T C 3: 133,191,674 (GRCm39) N920S probably benign Het
Tmem71 C T 15: 66,427,063 (GRCm39) S44N probably benign Het
Tmprss11f T A 5: 86,704,837 (GRCm39) D27V possibly damaging Het
Zfp747l1 G T 7: 126,984,079 (GRCm39) probably benign Het
Zxdc T A 6: 90,350,782 (GRCm39) I411N probably damaging Het
Other mutations in Col14a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Col14a1 APN 15 55,274,981 (GRCm39) missense unknown
IGL01290:Col14a1 APN 15 55,286,903 (GRCm39) missense unknown
IGL01300:Col14a1 APN 15 55,331,372 (GRCm39) missense unknown
IGL01505:Col14a1 APN 15 55,318,619 (GRCm39) missense unknown
IGL01533:Col14a1 APN 15 55,284,236 (GRCm39) missense unknown
IGL01563:Col14a1 APN 15 55,351,337 (GRCm39) missense unknown
IGL01650:Col14a1 APN 15 55,270,089 (GRCm39) missense unknown
IGL01659:Col14a1 APN 15 55,309,568 (GRCm39) unclassified probably benign
IGL01670:Col14a1 APN 15 55,192,662 (GRCm39) missense unknown
IGL01760:Col14a1 APN 15 55,286,855 (GRCm39) missense unknown
IGL01803:Col14a1 APN 15 55,282,210 (GRCm39) missense unknown
IGL01966:Col14a1 APN 15 55,312,121 (GRCm39) unclassified probably benign
IGL01990:Col14a1 APN 15 55,226,859 (GRCm39) missense unknown
IGL02124:Col14a1 APN 15 55,327,099 (GRCm39) missense unknown
IGL02138:Col14a1 APN 15 55,284,231 (GRCm39) missense unknown
IGL02192:Col14a1 APN 15 55,225,798 (GRCm39) missense unknown
IGL02326:Col14a1 APN 15 55,282,193 (GRCm39) missense unknown
IGL02335:Col14a1 APN 15 55,327,165 (GRCm39) splice site probably benign
IGL02407:Col14a1 APN 15 55,312,272 (GRCm39) splice site probably benign
IGL02486:Col14a1 APN 15 55,252,092 (GRCm39) splice site probably benign
IGL02537:Col14a1 APN 15 55,208,310 (GRCm39) nonsense probably null
IGL02567:Col14a1 APN 15 55,208,357 (GRCm39) critical splice donor site probably null
IGL02643:Col14a1 APN 15 55,284,258 (GRCm39) missense unknown
IGL02669:Col14a1 APN 15 55,282,178 (GRCm39) missense unknown
IGL02673:Col14a1 APN 15 55,282,178 (GRCm39) missense unknown
IGL02674:Col14a1 APN 15 55,282,178 (GRCm39) missense unknown
IGL03201:Col14a1 APN 15 55,272,300 (GRCm39) missense unknown
IGL03334:Col14a1 APN 15 55,312,217 (GRCm39) unclassified probably benign
IGL03370:Col14a1 APN 15 55,351,937 (GRCm39) splice site probably null
IGL03385:Col14a1 APN 15 55,273,600 (GRCm39) missense unknown
IGL03385:Col14a1 APN 15 55,335,104 (GRCm39) missense unknown
PIT4131001:Col14a1 UTSW 15 55,312,272 (GRCm39) splice site probably benign
R0046:Col14a1 UTSW 15 55,272,359 (GRCm39) splice site probably benign
R0046:Col14a1 UTSW 15 55,272,359 (GRCm39) splice site probably benign
R0173:Col14a1 UTSW 15 55,351,928 (GRCm39) missense probably damaging 1.00
R0242:Col14a1 UTSW 15 55,360,907 (GRCm39) missense probably damaging 1.00
R0242:Col14a1 UTSW 15 55,360,907 (GRCm39) missense probably damaging 1.00
R0359:Col14a1 UTSW 15 55,271,264 (GRCm39) splice site probably benign
R0391:Col14a1 UTSW 15 55,309,655 (GRCm39) unclassified probably benign
R0468:Col14a1 UTSW 15 55,252,042 (GRCm39) missense unknown
R0652:Col14a1 UTSW 15 55,208,278 (GRCm39) missense unknown
R0692:Col14a1 UTSW 15 55,205,134 (GRCm39) missense unknown
R0745:Col14a1 UTSW 15 55,201,813 (GRCm39) missense unknown
R1006:Col14a1 UTSW 15 55,383,331 (GRCm39) missense probably benign 0.04
R1331:Col14a1 UTSW 15 55,273,584 (GRCm39) missense unknown
R1537:Col14a1 UTSW 15 55,244,163 (GRCm39) missense unknown
R1557:Col14a1 UTSW 15 55,251,975 (GRCm39) missense unknown
R1721:Col14a1 UTSW 15 55,310,858 (GRCm39) unclassified probably benign
R1737:Col14a1 UTSW 15 55,208,357 (GRCm39) critical splice donor site probably benign
R1837:Col14a1 UTSW 15 55,245,891 (GRCm39) missense unknown
R1867:Col14a1 UTSW 15 55,310,858 (GRCm39) unclassified probably benign
R1868:Col14a1 UTSW 15 55,310,858 (GRCm39) unclassified probably benign
R1991:Col14a1 UTSW 15 55,313,336 (GRCm39) missense unknown
R2020:Col14a1 UTSW 15 55,309,577 (GRCm39) unclassified probably benign
R2103:Col14a1 UTSW 15 55,313,336 (GRCm39) missense unknown
R2116:Col14a1 UTSW 15 55,271,160 (GRCm39) missense unknown
R2163:Col14a1 UTSW 15 55,308,041 (GRCm39) unclassified probably benign
R2207:Col14a1 UTSW 15 55,327,082 (GRCm39) missense unknown
R2215:Col14a1 UTSW 15 55,244,238 (GRCm39) missense unknown
R2264:Col14a1 UTSW 15 55,330,086 (GRCm39) splice site probably null
R2383:Col14a1 UTSW 15 55,310,913 (GRCm39) unclassified probably benign
R2397:Col14a1 UTSW 15 55,201,835 (GRCm39) missense unknown
R2422:Col14a1 UTSW 15 55,313,318 (GRCm39) missense unknown
R3793:Col14a1 UTSW 15 55,226,909 (GRCm39) missense unknown
R4082:Col14a1 UTSW 15 55,300,429 (GRCm39) missense unknown
R4112:Col14a1 UTSW 15 55,226,955 (GRCm39) missense unknown
R4519:Col14a1 UTSW 15 55,251,975 (GRCm39) missense unknown
R4628:Col14a1 UTSW 15 55,313,229 (GRCm39) nonsense probably null
R4692:Col14a1 UTSW 15 55,286,864 (GRCm39) missense unknown
R4696:Col14a1 UTSW 15 55,235,998 (GRCm39) missense unknown
R4749:Col14a1 UTSW 15 55,315,732 (GRCm39) missense unknown
R5382:Col14a1 UTSW 15 55,225,832 (GRCm39) missense unknown
R5634:Col14a1 UTSW 15 55,381,694 (GRCm39) missense probably damaging 1.00
R5781:Col14a1 UTSW 15 55,286,908 (GRCm39) missense unknown
R5828:Col14a1 UTSW 15 55,300,372 (GRCm39) missense unknown
R5873:Col14a1 UTSW 15 55,309,182 (GRCm39) unclassified probably benign
R5966:Col14a1 UTSW 15 55,315,779 (GRCm39) critical splice donor site probably null
R6106:Col14a1 UTSW 15 55,383,404 (GRCm39) missense probably damaging 1.00
R6135:Col14a1 UTSW 15 55,244,246 (GRCm39) missense unknown
R6319:Col14a1 UTSW 15 55,379,565 (GRCm39) missense probably damaging 0.99
R6475:Col14a1 UTSW 15 55,309,218 (GRCm39) unclassified probably benign
R6540:Col14a1 UTSW 15 55,235,977 (GRCm39) missense unknown
R6893:Col14a1 UTSW 15 55,308,044 (GRCm39) unclassified probably benign
R6992:Col14a1 UTSW 15 55,274,958 (GRCm39) splice site probably null
R7284:Col14a1 UTSW 15 55,381,715 (GRCm39) missense probably damaging 1.00
R7404:Col14a1 UTSW 15 55,252,024 (GRCm39) nonsense probably null
R7655:Col14a1 UTSW 15 55,225,846 (GRCm39) missense unknown
R7656:Col14a1 UTSW 15 55,225,846 (GRCm39) missense unknown
R7715:Col14a1 UTSW 15 55,351,379 (GRCm39) missense unknown
R7841:Col14a1 UTSW 15 55,245,876 (GRCm39) missense unknown
R7861:Col14a1 UTSW 15 55,308,012 (GRCm39) missense unknown
R7866:Col14a1 UTSW 15 55,252,016 (GRCm39) missense unknown
R7902:Col14a1 UTSW 15 55,364,832 (GRCm39) missense probably benign 0.16
R8041:Col14a1 UTSW 15 55,318,626 (GRCm39) missense unknown
R8159:Col14a1 UTSW 15 55,291,324 (GRCm39) missense unknown
R8224:Col14a1 UTSW 15 55,271,137 (GRCm39) missense unknown
R8282:Col14a1 UTSW 15 55,284,276 (GRCm39) missense unknown
R8729:Col14a1 UTSW 15 55,310,893 (GRCm39) nonsense probably null
R8737:Col14a1 UTSW 15 55,318,706 (GRCm39) nonsense probably null
R8871:Col14a1 UTSW 15 55,245,958 (GRCm39) missense unknown
R9069:Col14a1 UTSW 15 55,251,990 (GRCm39) missense unknown
R9081:Col14a1 UTSW 15 55,291,387 (GRCm39) missense unknown
R9088:Col14a1 UTSW 15 55,226,923 (GRCm39) missense unknown
R9113:Col14a1 UTSW 15 55,201,825 (GRCm39) missense unknown
R9193:Col14a1 UTSW 15 55,242,964 (GRCm39) missense unknown
R9274:Col14a1 UTSW 15 55,381,671 (GRCm39) missense probably damaging 0.99
R9288:Col14a1 UTSW 15 55,286,918 (GRCm39) missense unknown
R9320:Col14a1 UTSW 15 55,364,780 (GRCm39) missense probably benign 0.16
R9602:Col14a1 UTSW 15 55,351,345 (GRCm39) missense unknown
R9620:Col14a1 UTSW 15 55,225,781 (GRCm39) missense unknown
R9629:Col14a1 UTSW 15 55,382,545 (GRCm39) missense
X0023:Col14a1 UTSW 15 55,286,843 (GRCm39) missense unknown
X0063:Col14a1 UTSW 15 55,273,611 (GRCm39) missense unknown
Z1177:Col14a1 UTSW 15 55,235,966 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGCTGTTTGACAAAGGGGTAC -3'
(R):5'- ATCAAGTCTTTCGCTGTGCAAC -3'

Sequencing Primer
(F):5'- GCATAAGCGTTCACATCTGTC -3'
(R):5'- CATGCAGCACGACATATTTTTAACC -3'
Posted On 2016-07-22