Incidental Mutation 'R5324:N6amt1'
ID405035
Institutional Source Beutler Lab
Gene Symbol N6amt1
Ensembl Gene ENSMUSG00000044442
Gene NameN-6 adenine-specific DNA methyltransferase 1 (putative)
SynonymsHemk2, Pred28, 5830445C04Rik
MMRRC Submission 042907-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5324 (G1)
Quality Score124
Status Not validated
Chromosome16
Chromosomal Location87354185-87368742 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87354353 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 34 (D34G)
Ref Sequence ENSEMBL: ENSMUSP00000112510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054442] [ENSMUST00000118115] [ENSMUST00000118310] [ENSMUST00000120284]
Predicted Effect probably damaging
Transcript: ENSMUST00000054442
AA Change: D34G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000061835
Gene: ENSMUSG00000044442
AA Change: D34G

DomainStartEndE-ValueType
Pfam:MTS 26 202 4.2e-12 PFAM
Pfam:Methyltransf_26 45 175 6.7e-15 PFAM
Pfam:Methyltransf_31 45 213 5.2e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118115
AA Change: D34G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113217
Gene: ENSMUSG00000044442
AA Change: D34G

DomainStartEndE-ValueType
Pfam:MTS 21 179 2e-14 PFAM
Pfam:Methyltransf_26 46 175 1.6e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118310
AA Change: D34G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113229
Gene: ENSMUSG00000044442
AA Change: D34G

DomainStartEndE-ValueType
Pfam:MTS 20 137 1.7e-12 PFAM
Pfam:PrmA 27 123 6.9e-7 PFAM
Pfam:Methyltransf_26 45 137 2.7e-13 PFAM
Pfam:Methyltransf_25 49 138 6.9e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120284
AA Change: D34G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112510
Gene: ENSMUSG00000044442
AA Change: D34G

DomainStartEndE-ValueType
Pfam:MTS 20 150 3.4e-12 PFAM
Pfam:PrmA 27 123 1.4e-6 PFAM
Pfam:Methyltransf_26 46 148 1.4e-12 PFAM
Pfam:Methyltransf_25 49 147 1.7e-7 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an N(6)-adenine-specific DNA methyltransferase. The encoded enzyme may be involved in the methylation of release factor I during translation termination. This enzyme is also involved in converting the arsenic metabolite monomethylarsonous acid to the less toxic dimethylarsonic acid. Alternative splicing pf this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 11. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele fail to form a primitive streak and die between E7.5 and E9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,907 probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ap5b1 G A 19: 5,569,835 E428K possibly damaging Het
Bmp2 C T 2: 133,561,359 R277* probably null Het
Cbl A T 9: 44,154,254 S659T probably damaging Het
Col14a1 A T 15: 55,338,445 H43L unknown Het
Corin A G 5: 72,435,257 C133R probably damaging Het
Cyp1a1 A G 9: 57,702,369 N401S probably benign Het
Dip2a T C 10: 76,296,393 D508G probably damaging Het
Dnah2 T A 11: 69,457,993 H2556L probably benign Het
Dock8 T C 19: 25,163,094 F1333L probably benign Het
Epg5 A G 18: 77,962,445 K717E possibly damaging Het
Fmn2 G A 1: 174,608,880 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hbp1 T C 12: 31,928,618 N510S probably damaging Het
Lrguk T C 6: 34,073,797 S397P possibly damaging Het
Mmrn1 A T 6: 60,976,586 D617V probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Nktr A T 9: 121,727,346 D30V probably damaging Het
Olfr1151 A T 2: 87,857,696 I174F probably damaging Het
Olfr598 T A 7: 103,329,050 M188K probably damaging Het
Olfr805 T A 10: 129,722,945 I200L probably benign Het
Pabpc1 A G 15: 36,600,625 F314L probably damaging Het
Papln G A 12: 83,774,571 V226M probably damaging Het
Parp12 A T 6: 39,102,612 D321E probably damaging Het
Plch2 T A 4: 154,984,534 T1107S probably benign Het
Psma2 T C 13: 14,625,217 L182P probably damaging Het
Rcl1 A G 19: 29,128,001 Y196C probably benign Het
Rdh16 G A 10: 127,801,267 V24M probably damaging Het
Rpe65 A G 3: 159,604,404 T105A possibly damaging Het
Serpini1 T C 3: 75,640,294 I371T probably damaging Het
Tet2 T C 3: 133,485,913 N920S probably benign Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tmprss11f T A 5: 86,556,978 D27V possibly damaging Het
Zxdc T A 6: 90,373,800 I411N probably damaging Het
Other mutations in N6amt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1079:N6amt1 UTSW 16 87356198 missense probably damaging 0.98
R3028:N6amt1 UTSW 16 87362648 missense probably benign 0.00
R4692:N6amt1 UTSW 16 87356966 missense possibly damaging 0.65
R5686:N6amt1 UTSW 16 87354335 missense probably damaging 1.00
R7001:N6amt1 UTSW 16 87354292 missense probably benign 0.30
R7223:N6amt1 UTSW 16 87362660 makesense probably null
R7419:N6amt1 UTSW 16 87367566 missense possibly damaging 0.63
R8084:N6amt1 UTSW 16 87354340 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGTGTAAGACAAAAGCGC -3'
(R):5'- GAGGCGCGTTTACATTCTTC -3'

Sequencing Primer
(F):5'- AGACAAAAGCGCATGCGCAGCAAGCC -3'
(R):5'- GGCGCGTTTACATTCTTCAGATTAAC -3'
Posted On2016-07-22