Incidental Mutation 'R5324:Ap5b1'
ID405038
Institutional Source Beutler Lab
Gene Symbol Ap5b1
Ensembl Gene ENSMUSG00000049562
Gene Nameadaptor-related protein complex 5, beta 1 subunit
SynonymsGm962
MMRRC Submission 042907-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R5324 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location5568074-5571261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 5569835 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 428 (E428K)
Ref Sequence ENSEMBL: ENSMUSP00000094042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096318]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096318
AA Change: E428K

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000094042
Gene: ENSMUSG00000049562
AA Change: E428K

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 68 75 N/A INTRINSIC
low complexity region 84 104 N/A INTRINSIC
low complexity region 114 136 N/A INTRINSIC
low complexity region 185 199 N/A INTRINSIC
low complexity region 283 301 N/A INTRINSIC
low complexity region 410 428 N/A INTRINSIC
low complexity region 511 524 N/A INTRINSIC
low complexity region 616 644 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,907 probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Bmp2 C T 2: 133,561,359 R277* probably null Het
Cbl A T 9: 44,154,254 S659T probably damaging Het
Col14a1 A T 15: 55,338,445 H43L unknown Het
Corin A G 5: 72,435,257 C133R probably damaging Het
Cyp1a1 A G 9: 57,702,369 N401S probably benign Het
Dip2a T C 10: 76,296,393 D508G probably damaging Het
Dnah2 T A 11: 69,457,993 H2556L probably benign Het
Dock8 T C 19: 25,163,094 F1333L probably benign Het
Epg5 A G 18: 77,962,445 K717E possibly damaging Het
Fmn2 G A 1: 174,608,880 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hbp1 T C 12: 31,928,618 N510S probably damaging Het
Lrguk T C 6: 34,073,797 S397P possibly damaging Het
Mmrn1 A T 6: 60,976,586 D617V probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
N6amt1 A G 16: 87,354,353 D34G probably damaging Het
Nktr A T 9: 121,727,346 D30V probably damaging Het
Olfr1151 A T 2: 87,857,696 I174F probably damaging Het
Olfr598 T A 7: 103,329,050 M188K probably damaging Het
Olfr805 T A 10: 129,722,945 I200L probably benign Het
Pabpc1 A G 15: 36,600,625 F314L probably damaging Het
Papln G A 12: 83,774,571 V226M probably damaging Het
Parp12 A T 6: 39,102,612 D321E probably damaging Het
Plch2 T A 4: 154,984,534 T1107S probably benign Het
Psma2 T C 13: 14,625,217 L182P probably damaging Het
Rcl1 A G 19: 29,128,001 Y196C probably benign Het
Rdh16 G A 10: 127,801,267 V24M probably damaging Het
Rpe65 A G 3: 159,604,404 T105A possibly damaging Het
Serpini1 T C 3: 75,640,294 I371T probably damaging Het
Tet2 T C 3: 133,485,913 N920S probably benign Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tmprss11f T A 5: 86,556,978 D27V possibly damaging Het
Zxdc T A 6: 90,373,800 I411N probably damaging Het
Other mutations in Ap5b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01906:Ap5b1 APN 19 5570979 nonsense probably null
IGL02121:Ap5b1 APN 19 5570787 missense possibly damaging 0.92
R1513:Ap5b1 UTSW 19 5569864 nonsense probably null
R2004:Ap5b1 UTSW 19 5570474 missense possibly damaging 0.83
R2036:Ap5b1 UTSW 19 5568869 missense possibly damaging 0.83
R2282:Ap5b1 UTSW 19 5569637 missense possibly damaging 0.66
R3441:Ap5b1 UTSW 19 5569983 missense probably benign
R3835:Ap5b1 UTSW 19 5568890 missense possibly damaging 0.66
R4241:Ap5b1 UTSW 19 5568797 missense possibly damaging 0.92
R5359:Ap5b1 UTSW 19 5569098 missense possibly damaging 0.83
R7102:Ap5b1 UTSW 19 5570187 missense possibly damaging 0.92
R7132:Ap5b1 UTSW 19 5569384 nonsense probably null
R8548:Ap5b1 UTSW 19 5571095 missense possibly damaging 0.46
Z1088:Ap5b1 UTSW 19 5570424 missense possibly damaging 0.82
Z1177:Ap5b1 UTSW 19 5570928 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCTTCCCCGAGAATTGC -3'
(R):5'- CCTGATCTAAGAGGTCCACAAAGTG -3'

Sequencing Primer
(F):5'- GAATTGCCCACTAGGTCCAGAG -3'
(R):5'- CAGTCCGCGGATCAAAAATGTCTG -3'
Posted On2016-07-22