Incidental Mutation 'R5324:Ap5b1'
ID 405038
Institutional Source Beutler Lab
Gene Symbol Ap5b1
Ensembl Gene ENSMUSG00000049562
Gene Name adaptor-related protein complex 5, beta 1 subunit
Synonyms Gm962
MMRRC Submission 042907-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.118) question?
Stock # R5324 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 5618053-5621289 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 5619863 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 428 (E428K)
Ref Sequence ENSEMBL: ENSMUSP00000094042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096318]
AlphaFold Q3TAP4
Predicted Effect possibly damaging
Transcript: ENSMUST00000096318
AA Change: E428K

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000094042
Gene: ENSMUSG00000049562
AA Change: E428K

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 68 75 N/A INTRINSIC
low complexity region 84 104 N/A INTRINSIC
low complexity region 114 136 N/A INTRINSIC
low complexity region 185 199 N/A INTRINSIC
low complexity region 283 301 N/A INTRINSIC
low complexity region 410 428 N/A INTRINSIC
low complexity region 511 524 N/A INTRINSIC
low complexity region 616 644 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap10 C T 11: 61,807,015 (GRCm39) A72T probably damaging Het
Bmp2 C T 2: 133,403,279 (GRCm39) R277* probably null Het
Cbl A T 9: 44,065,551 (GRCm39) S659T probably damaging Het
Col14a1 A T 15: 55,201,841 (GRCm39) H43L unknown Het
Corin A G 5: 72,592,600 (GRCm39) C133R probably damaging Het
Cyp1a1 A G 9: 57,609,652 (GRCm39) N401S probably benign Het
Dip2a T C 10: 76,132,227 (GRCm39) D508G probably damaging Het
Dnah2 T A 11: 69,348,819 (GRCm39) H2556L probably benign Het
Dock8 T C 19: 25,140,458 (GRCm39) F1333L probably benign Het
Epg5 A G 18: 78,005,660 (GRCm39) K717E possibly damaging Het
Fmn2 G A 1: 174,436,446 (GRCm39) probably benign Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Hbp1 T C 12: 31,978,617 (GRCm39) N510S probably damaging Het
Lrguk T C 6: 34,050,732 (GRCm39) S397P possibly damaging Het
Mmrn1 A T 6: 60,953,570 (GRCm39) D617V probably damaging Het
Mroh9 C G 1: 162,888,329 (GRCm39) G249R probably damaging Het
N6amt1 A G 16: 87,151,241 (GRCm39) D34G probably damaging Het
Nktr A T 9: 121,556,412 (GRCm39) D30V probably damaging Het
Or52ab7 T A 7: 102,978,257 (GRCm39) M188K probably damaging Het
Or5w8 A T 2: 87,688,040 (GRCm39) I174F probably damaging Het
Or6c212 T A 10: 129,558,814 (GRCm39) I200L probably benign Het
Pabpc1 A G 15: 36,600,869 (GRCm39) F314L probably damaging Het
Papln G A 12: 83,821,345 (GRCm39) V226M probably damaging Het
Parp12 A T 6: 39,079,546 (GRCm39) D321E probably damaging Het
Plch2 T A 4: 155,068,991 (GRCm39) T1107S probably benign Het
Psma2 T C 13: 14,799,802 (GRCm39) L182P probably damaging Het
Rcl1 A G 19: 29,105,401 (GRCm39) Y196C probably benign Het
Rdh16 G A 10: 127,637,136 (GRCm39) V24M probably damaging Het
Rpe65 A G 3: 159,310,041 (GRCm39) T105A possibly damaging Het
Serpini1 T C 3: 75,547,601 (GRCm39) I371T probably damaging Het
Tet2 T C 3: 133,191,674 (GRCm39) N920S probably benign Het
Tmem71 C T 15: 66,427,063 (GRCm39) S44N probably benign Het
Tmprss11f T A 5: 86,704,837 (GRCm39) D27V possibly damaging Het
Zfp747l1 G T 7: 126,984,079 (GRCm39) probably benign Het
Zxdc T A 6: 90,350,782 (GRCm39) I411N probably damaging Het
Other mutations in Ap5b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01906:Ap5b1 APN 19 5,621,007 (GRCm39) nonsense probably null
IGL02121:Ap5b1 APN 19 5,620,815 (GRCm39) missense possibly damaging 0.92
R1513:Ap5b1 UTSW 19 5,619,892 (GRCm39) nonsense probably null
R2004:Ap5b1 UTSW 19 5,620,502 (GRCm39) missense possibly damaging 0.83
R2036:Ap5b1 UTSW 19 5,618,897 (GRCm39) missense possibly damaging 0.83
R2282:Ap5b1 UTSW 19 5,619,665 (GRCm39) missense possibly damaging 0.66
R3441:Ap5b1 UTSW 19 5,620,011 (GRCm39) missense probably benign
R3835:Ap5b1 UTSW 19 5,618,918 (GRCm39) missense possibly damaging 0.66
R4241:Ap5b1 UTSW 19 5,618,825 (GRCm39) missense possibly damaging 0.92
R5359:Ap5b1 UTSW 19 5,619,126 (GRCm39) missense possibly damaging 0.83
R7102:Ap5b1 UTSW 19 5,620,215 (GRCm39) missense possibly damaging 0.92
R7132:Ap5b1 UTSW 19 5,619,412 (GRCm39) nonsense probably null
R8548:Ap5b1 UTSW 19 5,621,123 (GRCm39) missense possibly damaging 0.46
Z1088:Ap5b1 UTSW 19 5,620,452 (GRCm39) missense possibly damaging 0.82
Z1177:Ap5b1 UTSW 19 5,620,956 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCTTCCCCGAGAATTGC -3'
(R):5'- CCTGATCTAAGAGGTCCACAAAGTG -3'

Sequencing Primer
(F):5'- GAATTGCCCACTAGGTCCAGAG -3'
(R):5'- CAGTCCGCGGATCAAAAATGTCTG -3'
Posted On 2016-07-22