Incidental Mutation 'R5189:Ly96'
ID405040
Institutional Source Beutler Lab
Gene Symbol Ly96
Ensembl Gene ENSMUSG00000025779
Gene Namelymphocyte antigen 96
SynonymsMD-2, ESOP-1, MD2, myeloid differentiation factor-2
MMRRC Submission 042767-MU
Accession Numbers

Ncbi RefSeq: NM_016923; MGI: 1341909

Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R5189 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location16688051-16709611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16700867 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 74 (E74G)
Ref Sequence ENSEMBL: ENSMUSP00000140411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026881] [ENSMUST00000190366]
Predicted Effect probably damaging
Transcript: ENSMUST00000026881
AA Change: E92G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026881
Gene: ENSMUSG00000025779
AA Change: E92G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
ML 34 153 7.82e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190366
AA Change: E74G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140411
Gene: ENSMUSG00000025779
AA Change: E74G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:E1_DerP2_DerF2 66 137 1.8e-11 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which associates with toll-like receptor 4 on the cell surface and confers responsiveness to lipopolysaccyaride (LPS), thus providing a link between the receptor and LPS signaling. Studies of the mouse ortholog suggest that this gene may be involved in endotoxin neutralization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired responsiveness to LPS, are resistant to LPS-induced lethal toxicity but show increased susceptibility to Salmonella typhimurium infection. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik C T 12: 71,193,349 T1311I possibly damaging Het
4930505A04Rik T C 11: 30,426,169 T233A probably damaging Het
Ankar T C 1: 72,658,414 I859V probably benign Het
Cacnb2 G T 2: 14,986,038 A644S possibly damaging Het
Gatb T C 3: 85,636,931 V402A probably benign Het
Gpcpd1 T C 2: 132,553,972 K153R probably damaging Het
Hip1 A G 5: 135,434,293 L60S probably damaging Het
Hsf4 GCAGCACCGGGTCA G 8: 105,271,428 probably null Het
Hydin A T 8: 110,413,211 probably null Het
Igsf3 A T 3: 101,431,527 T386S possibly damaging Het
Il12rb1 A G 8: 70,811,058 T88A possibly damaging Het
Kank1 T C 19: 25,424,181 S1051P probably damaging Het
Kap A G 6: 133,851,916 probably null Het
Map7d1 G T 4: 126,242,304 probably null Het
Megf6 G T 4: 154,252,523 R253L probably benign Het
Mex3b A G 7: 82,869,251 D258G probably damaging Het
Mpzl3 T C 9: 45,062,110 I49T possibly damaging Het
Myh15 C A 16: 49,101,507 T472N probably benign Het
Nacad A G 11: 6,601,611 S527P probably damaging Het
Nkx2-3 T G 19: 43,612,708 S70A probably benign Het
Nkx2-6 A T 14: 69,171,893 Q31L probably benign Het
Olfr522 A G 7: 140,162,719 V77A probably damaging Het
Pcdha6 A T 18: 36,968,791 N346Y probably damaging Het
Pkd2 G A 5: 104,459,919 D95N probably benign Het
Pkhd1l1 A G 15: 44,547,148 T2684A probably damaging Het
Plin2 A G 4: 86,657,146 Y389H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc41a2 T C 10: 83,313,411 probably null Het
Smg6 A G 11: 75,041,996 T1038A probably damaging Het
Suds3 T C 5: 117,100,599 probably benign Het
Tbc1d8 T C 1: 39,385,132 H626R probably benign Het
Tmem260 T A 14: 48,509,116 H616Q probably benign Het
Trip10 A T 17: 57,261,288 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 A G 4: 139,410,649 T1106A probably benign Het
Vmn1r84 A T 7: 12,362,458 S103T probably benign Het
Vps13a G T 19: 16,685,315 P1602Q probably damaging Het
Other mutations in Ly96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Ly96 APN 1 16706228 splice site probably null
IGL01588:Ly96 APN 1 16709454 missense probably benign 0.11
pique UTSW 1 16691716 nonsense probably null
H8562:Ly96 UTSW 1 16691694 missense probably damaging 1.00
R1186:Ly96 UTSW 1 16700894 missense possibly damaging 0.90
R1751:Ly96 UTSW 1 16706175 missense probably benign 0.00
R1767:Ly96 UTSW 1 16706175 missense probably benign 0.00
R4645:Ly96 UTSW 1 16691716 nonsense probably null
R5470:Ly96 UTSW 1 16709486 missense probably benign 0.16
R7031:Ly96 UTSW 1 16688563 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- GACAACCATGATGATCAAATGAAGC -3'
(R):5'- GGGTTTCTTTGTCCTAACAGCC -3'

Sequencing Primer
(F):5'- CATGATGATCAAATGAAGCATCAAAG -3'
(R):5'- GGTTAAGAGCAGTGACTACTCTCC -3'
Posted On2016-07-22