Mutagenetix > Incidental Mutations

Incidental Mutation 'R5189:Cacnb2'

405044

Institutional Source

Beutler Lab

Gene Symbol

Cacnb2

Ensembl Gene

ENSMUSG00000057914

Gene Name

calcium channel, voltage-dependent, beta 2 subunit

Synonyms

Cchb2, Cavbeta2

MMRRC Submission

042767-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5189 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

14603088-14987908 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 14986038 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 644 (A644S)

Ref Sequence

ENSEMBL: ENSMUSP00000110371 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114719] [ENSMUST00000114723] [ENSMUST00000193800]

Predicted Effect

probably benign
Transcript: ENSMUST00000114719
AA Change: A600S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000110367
Gene: ENSMUSG00000057914
AA Change: A600S

Domain	Start	End	E-Value	Type
Pfam:VGCC_beta4Aa_N	24	65	1.7e-26	PFAM
SH3	69	133	2.42e-2	SMART
low complexity region	149	161	N/A	INTRINSIC
GuKc	232	414	6.11e-38	SMART
low complexity region	419	448	N/A	INTRINSIC
low complexity region	546	561	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114723
AA Change: A644S

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000110371
Gene: ENSMUSG00000057914
AA Change: A644S

Domain	Start	End	E-Value	Type
low complexity region	50	61	N/A	INTRINSIC
Pfam:VGCC_beta4Aa_N	68	109	2.7e-25	PFAM
SH3	113	177	2.42e-2	SMART
low complexity region	193	205	N/A	INTRINSIC
GuKc	276	458	6.11e-38	SMART
low complexity region	463	492	N/A	INTRINSIC
low complexity region	590	605	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144423

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193262

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193452

Predicted Effect

probably benign
Transcript: ENSMUST00000193522

Predicted Effect

probably benign
Transcript: ENSMUST00000193800
AA Change: A594S

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000141221
Gene: ENSMUSG00000057914
AA Change: A594S

Domain	Start	End	E-Value	Type
Pfam:VGCC_beta4Aa_N	18	59	3.2e-27	PFAM
SH3	63	127	2.42e-2	SMART
low complexity region	143	155	N/A	INTRINSIC
GuKc	226	408	6.11e-38	SMART
low complexity region	413	442	N/A	INTRINSIC
low complexity region	540	555	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a voltage-dependent calcium channel protein that is a member of the voltage-gated calcium channel superfamily. The gene product was originally identified as an antigen target in Lambert-Eaton myasthenic syndrome, an autoimmune disorder. Mutations in this gene are associated with Brugada syndrome. Alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit lethality at E10.5 with growth retardation, abnormal yolk vasculature and abnormal cardiac development and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
2700049A03Rik	C	T	12: 71,193,349	T1311I	possibly damaging	Het
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
4930505A04Rik	T	C	11: 30,426,169	T233A	probably damaging	Het
Ankar	T	C	1: 72,658,414	I859V	probably benign	Het
Gatb	T	C	3: 85,636,931	V402A	probably benign	Het
Gpcpd1	T	C	2: 132,553,972	K153R	probably damaging	Het
Hip1	A	G	5: 135,434,293	L60S	probably damaging	Het
Hsf4	GCAGCACCGGGTCA	G	8: 105,271,428		probably null	Het
Hydin	A	T	8: 110,413,211		probably null	Het
Igsf3	A	T	3: 101,431,527	T386S	possibly damaging	Het
Il12rb1	A	G	8: 70,811,058	T88A	possibly damaging	Het
Kank1	T	C	19: 25,424,181	S1051P	probably damaging	Het
Kap	A	G	6: 133,851,916		probably null	Het
Ly96	A	G	1: 16,700,867	E74G	probably damaging	Het
Map7d1	G	T	4: 126,242,304		probably null	Het
Megf6	G	T	4: 154,252,523	R253L	probably benign	Het
Mex3b	A	G	7: 82,869,251	D258G	probably damaging	Het
Mpzl3	T	C	9: 45,062,110	I49T	possibly damaging	Het
Myh15	C	A	16: 49,101,507	T472N	probably benign	Het
Nacad	A	G	11: 6,601,611	S527P	probably damaging	Het
Nkx2-3	T	G	19: 43,612,708	S70A	probably benign	Het
Nkx2-6	A	T	14: 69,171,893	Q31L	probably benign	Het
Olfr522	A	G	7: 140,162,719	V77A	probably damaging	Het
Pcdha6	A	T	18: 36,968,791	N346Y	probably damaging	Het
Pkd2	G	A	5: 104,459,919	D95N	probably benign	Het
Pkhd1l1	A	G	15: 44,547,148	T2684A	probably damaging	Het
Plin2	A	G	4: 86,657,146	Y389H	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Slc41a2	T	C	10: 83,313,411		probably null	Het
Smg6	A	G	11: 75,041,996	T1038A	probably damaging	Het
Suds3	T	C	5: 117,100,599		probably benign	Het
Tbc1d8	T	C	1: 39,385,132	H626R	probably benign	Het
Tmem260	T	A	14: 48,509,116	H616Q	probably benign	Het
Trip10	A	T	17: 57,261,288		probably null	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ubr4	A	G	4: 139,410,649	T1106A	probably benign	Het
Vmn1r84	A	T	7: 12,362,458	S103T	probably benign	Het
Vps13a	G	T	19: 16,685,315	P1602Q	probably damaging	Het

Other mutations in Cacnb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01527:Cacnb2	APN	2	14984270	missense	possibly damaging	0.95
IGL01806:Cacnb2	APN	2	14614268	missense	probably damaging	1.00
IGL01939:Cacnb2	APN	2	14971569	missense	probably benign	0.16
IGL02941:Cacnb2	APN	2	14958829	missense	probably benign	0.00
PIT1430001:Cacnb2	UTSW	2	14971601	nonsense	probably null
PIT4498001:Cacnb2	UTSW	2	14874819	nonsense	probably null
PIT4508001:Cacnb2	UTSW	2	14984419	missense	probably benign	0.00
R0095:Cacnb2	UTSW	2	14958775	missense	probably damaging	1.00
R0731:Cacnb2	UTSW	2	14985706	missense	possibly damaging	0.95
R1521:Cacnb2	UTSW	2	14614352	missense	probably benign	0.18
R1829:Cacnb2	UTSW	2	14985964	missense	possibly damaging	0.89
R2174:Cacnb2	UTSW	2	14958767	missense	probably benign	0.21
R2471:Cacnb2	UTSW	2	14984314	missense	probably damaging	1.00
R2473:Cacnb2	UTSW	2	14984314	missense	probably damaging	1.00
R3801:Cacnb2	UTSW	2	14824263	missense	possibly damaging	0.85
R3831:Cacnb2	UTSW	2	14981425	missense	probably damaging	1.00
R3832:Cacnb2	UTSW	2	14981425	missense	probably damaging	1.00
R3833:Cacnb2	UTSW	2	14981425	missense	probably damaging	1.00
R3981:Cacnb2	UTSW	2	14604503	missense	probably benign
R4231:Cacnb2	UTSW	2	14981440	missense	probably damaging	1.00
R4426:Cacnb2	UTSW	2	14975215	nonsense	probably null
R4569:Cacnb2	UTSW	2	14986000	missense	possibly damaging	0.94
R4815:Cacnb2	UTSW	2	14874780	missense	probably damaging	1.00
R4911:Cacnb2	UTSW	2	14981340	missense	possibly damaging	0.83
R6114:Cacnb2	UTSW	2	14975201	missense	possibly damaging	0.88
R6158:Cacnb2	UTSW	2	14985601	missense	possibly damaging	0.62
R6530:Cacnb2	UTSW	2	14975167	missense	probably damaging	1.00
R6612:Cacnb2	UTSW	2	14975149	missense	probably benign	0.41
R6882:Cacnb2	UTSW	2	14824299	missense	probably benign	0.00
R6889:Cacnb2	UTSW	2	14986015	missense	possibly damaging	0.55
R7804:Cacnb2	UTSW	2	14968037	missense	probably benign	0.08
R7820:Cacnb2	UTSW	2	14960666	missense	probably damaging	1.00
R7971:Cacnb2	UTSW	2	14971598	missense	possibly damaging	0.51
R7980:Cacnb2	UTSW	2	14604515	missense	probably benign
R7993:Cacnb2	UTSW	2	14963920	missense	probably benign	0.16
R8762:Cacnb2	UTSW	2	14967948	missense	possibly damaging	0.71

Predicted Primers

PCR Primer
(F):5'- GAACATGTGGACCGGTATGTC -3'
(R):5'- GCAGCTGTACTAGGCCAATTTC -3'

Sequencing Primer
(F):5'- TATGTCCCACACCGCGAG -3'
(R):5'- ACTAGGCCAATTTCTGTGGTAC -3'

Posted On

2016-07-22