Incidental Mutation 'R5189:Gatb'
ID405047
Institutional Source Beutler Lab
Gene Symbol Gatb
Ensembl Gene ENSMUSG00000028085
Gene Nameglutamyl-tRNA(Gln) amidotransferase, subunit B
SynonymsPet112, Pet112l, 9430026F02Rik
MMRRC Submission 042767-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R5189 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location85574119-85655622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85636931 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 402 (V402A)
Ref Sequence ENSEMBL: ENSMUSP00000103301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107672] [ENSMUST00000107674] [ENSMUST00000127348] [ENSMUST00000154148]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000029726
Predicted Effect probably benign
Transcript: ENSMUST00000107672
AA Change: V402A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103299
Gene: ENSMUSG00000028085
AA Change: V402A

DomainStartEndE-ValueType
Pfam:GatB_N 65 353 8.3e-103 PFAM
Pfam:GatB_Yqey 406 472 6.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107674
AA Change: V402A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000103301
Gene: ENSMUSG00000028085
AA Change: V402A

DomainStartEndE-ValueType
Pfam:GatB_N 64 354 6.7e-105 PFAM
GatB_Yqey 406 518 2.09e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127348
AA Change: V402A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119949
Gene: ENSMUSG00000028085
AA Change: V402A

DomainStartEndE-ValueType
Pfam:GatB_N 65 353 8.3e-101 PFAM
GatB_Yqey 406 555 4.13e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154148
SMART Domains Protein: ENSMUSP00000116393
Gene: ENSMUSG00000102805

DomainStartEndE-ValueType
Arfaptin 1 227 7.15e-121 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik C T 12: 71,193,349 T1311I possibly damaging Het
4930505A04Rik T C 11: 30,426,169 T233A probably damaging Het
Ankar T C 1: 72,658,414 I859V probably benign Het
Cacnb2 G T 2: 14,986,038 A644S possibly damaging Het
Gpcpd1 T C 2: 132,553,972 K153R probably damaging Het
Hip1 A G 5: 135,434,293 L60S probably damaging Het
Hsf4 GCAGCACCGGGTCA G 8: 105,271,428 probably null Het
Hydin A T 8: 110,413,211 probably null Het
Igsf3 A T 3: 101,431,527 T386S possibly damaging Het
Il12rb1 A G 8: 70,811,058 T88A possibly damaging Het
Kank1 T C 19: 25,424,181 S1051P probably damaging Het
Kap A G 6: 133,851,916 probably null Het
Ly96 A G 1: 16,700,867 E74G probably damaging Het
Map7d1 G T 4: 126,242,304 probably null Het
Megf6 G T 4: 154,252,523 R253L probably benign Het
Mex3b A G 7: 82,869,251 D258G probably damaging Het
Mpzl3 T C 9: 45,062,110 I49T possibly damaging Het
Myh15 C A 16: 49,101,507 T472N probably benign Het
Nacad A G 11: 6,601,611 S527P probably damaging Het
Nkx2-3 T G 19: 43,612,708 S70A probably benign Het
Nkx2-6 A T 14: 69,171,893 Q31L probably benign Het
Olfr522 A G 7: 140,162,719 V77A probably damaging Het
Pcdha6 A T 18: 36,968,791 N346Y probably damaging Het
Pkd2 G A 5: 104,459,919 D95N probably benign Het
Pkhd1l1 A G 15: 44,547,148 T2684A probably damaging Het
Plin2 A G 4: 86,657,146 Y389H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc41a2 T C 10: 83,313,411 probably null Het
Smg6 A G 11: 75,041,996 T1038A probably damaging Het
Suds3 T C 5: 117,100,599 probably benign Het
Tbc1d8 T C 1: 39,385,132 H626R probably benign Het
Tmem260 T A 14: 48,509,116 H616Q probably benign Het
Trip10 A T 17: 57,261,288 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 A G 4: 139,410,649 T1106A probably benign Het
Vmn1r84 A T 7: 12,362,458 S103T probably benign Het
Vps13a G T 19: 16,685,315 P1602Q probably damaging Het
Other mutations in Gatb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Gatb APN 3 85601920 missense possibly damaging 0.95
IGL00963:Gatb APN 3 85618948 missense probably benign 0.00
IGL01363:Gatb APN 3 85652345 missense probably damaging 1.00
IGL01650:Gatb APN 3 85613484 missense possibly damaging 0.68
IGL01973:Gatb APN 3 85611424 missense probably damaging 1.00
IGL02195:Gatb APN 3 85604448 missense probably benign 0.00
IGL02670:Gatb APN 3 85613551 splice site probably null
IGL02992:Gatb APN 3 85618916 missense probably damaging 1.00
IGL03025:Gatb APN 3 85575874 missense probably damaging 0.99
IGL03035:Gatb APN 3 85601947 missense probably damaging 1.00
IGL03090:Gatb APN 3 85619023 intron probably benign
R1313:Gatb UTSW 3 85653826 missense probably benign 0.01
R1851:Gatb UTSW 3 85618877 missense probably damaging 0.99
R1852:Gatb UTSW 3 85618877 missense probably damaging 0.99
R2134:Gatb UTSW 3 85611370 missense probably damaging 1.00
R2209:Gatb UTSW 3 85653805 missense probably benign 0.03
R5218:Gatb UTSW 3 85604444 missense probably benign
R5857:Gatb UTSW 3 85575932 missense probably damaging 1.00
R5871:Gatb UTSW 3 85653776 nonsense probably null
R6031:Gatb UTSW 3 85613511 missense possibly damaging 0.82
R6031:Gatb UTSW 3 85613511 missense possibly damaging 0.82
R6430:Gatb UTSW 3 85637038 missense probably benign 0.01
R6661:Gatb UTSW 3 85652419 splice site probably null
R7184:Gatb UTSW 3 85636951 nonsense probably null
R7210:Gatb UTSW 3 85574220 missense probably benign
R7501:Gatb UTSW 3 85636990 missense probably damaging 0.99
X0013:Gatb UTSW 3 85601861 missense probably damaging 1.00
Z1177:Gatb UTSW 3 85636973 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACAGACTGCTCTGGTGAC -3'
(R):5'- AACTCAAAGGGGATTGTTTGTC -3'

Sequencing Primer
(F):5'- TGACAGCTCAGTGTTTCAGAAG -3'
(R):5'- CTATTTCAATTGCCTCTGGACAG -3'
Posted On2016-07-22