Mutagenetix > Incidental Mutations

Incidental Mutation 'R5189:Hip1'

405054

Institutional Source

Beutler Lab

Gene Symbol

Hip1

Ensembl Gene

ENSMUSG00000039959

Gene Name

huntingtin interacting protein 1

Synonyms

HIP-1, 2610109B09Rik, A930014B11Rik, E130315I21Rik

MMRRC Submission

042767-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.790) question?

Stock #

R5189 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

135406531-135545120 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 135434293 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 60 (L60S)

Ref Sequence

ENSEMBL: ENSMUSP00000144086 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060311] [ENSMUST00000202643] [ENSMUST00000212301]

Predicted Effect

probably damaging
Transcript: ENSMUST00000060311
AA Change: L471S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000059033
Gene: ENSMUSG00000039959
AA Change: L471S

Domain	Start	End	E-Value	Type
ENTH	38	160	9.98e-41	SMART
PDB:3I00\|B	361	480	9e-57	PDB
Pfam:HIP1_clath_bdg	482	572	2.1e-27	PFAM
low complexity region	649	658	N/A	INTRINSIC
low complexity region	780	796	N/A	INTRINSIC
ILWEQ	806	1004	9.05e-120	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000200808

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200898

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201479

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202236

Predicted Effect

probably damaging
Transcript: ENSMUST00000202643
AA Change: L60S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144086
Gene: ENSMUSG00000039959
AA Change: L60S

Domain	Start	End	E-Value	Type
PDB:2QA7\|D	1	70	9e-34	PDB
Pfam:HIP1_clath_bdg	71	161	4.4e-24	PFAM
low complexity region	238	247	N/A	INTRINSIC
low complexity region	369	385	N/A	INTRINSIC
ILWEQ	395	593	5.7e-122	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000212301

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a membrane-associated protein that functions in clathrin-mediated endocytosis and protein trafficking within the cell. The encoded protein binds to the huntingtin protein in the brain; this interaction is lost in Huntington's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutants may exhibit axial skeleton defects, hematopotietic abnormalities, and testicular degeneration with increased apoptosis of postmeiotic spermatids. One line showed microphthalmia and cataracts, whereas others did not. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
2700049A03Rik	C	T	12: 71,193,349	T1311I	possibly damaging	Het
4930505A04Rik	T	C	11: 30,426,169	T233A	probably damaging	Het
Ankar	T	C	1: 72,658,414	I859V	probably benign	Het
Cacnb2	G	T	2: 14,986,038	A644S	possibly damaging	Het
Gatb	T	C	3: 85,636,931	V402A	probably benign	Het
Gpcpd1	T	C	2: 132,553,972	K153R	probably damaging	Het
Hsf4	GCAGCACCGGGTCA	G	8: 105,271,428		probably null	Het
Hydin	A	T	8: 110,413,211		probably null	Het
Igsf3	A	T	3: 101,431,527	T386S	possibly damaging	Het
Il12rb1	A	G	8: 70,811,058	T88A	possibly damaging	Het
Kank1	T	C	19: 25,424,181	S1051P	probably damaging	Het
Kap	A	G	6: 133,851,916		probably null	Het
Ly96	A	G	1: 16,700,867	E74G	probably damaging	Het
Map7d1	G	T	4: 126,242,304		probably null	Het
Megf6	G	T	4: 154,252,523	R253L	probably benign	Het
Mex3b	A	G	7: 82,869,251	D258G	probably damaging	Het
Mpzl3	T	C	9: 45,062,110	I49T	possibly damaging	Het
Myh15	C	A	16: 49,101,507	T472N	probably benign	Het
Nacad	A	G	11: 6,601,611	S527P	probably damaging	Het
Nkx2-3	T	G	19: 43,612,708	S70A	probably benign	Het
Nkx2-6	A	T	14: 69,171,893	Q31L	probably benign	Het
Olfr522	A	G	7: 140,162,719	V77A	probably damaging	Het
Pcdha6	A	T	18: 36,968,791	N346Y	probably damaging	Het
Pkd2	G	A	5: 104,459,919	D95N	probably benign	Het
Pkhd1l1	A	G	15: 44,547,148	T2684A	probably damaging	Het
Plin2	A	G	4: 86,657,146	Y389H	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Slc41a2	T	C	10: 83,313,411		probably null	Het
Smg6	A	G	11: 75,041,996	T1038A	probably damaging	Het
Suds3	T	C	5: 117,100,599		probably benign	Het
Tbc1d8	T	C	1: 39,385,132	H626R	probably benign	Het
Tmem260	T	A	14: 48,509,116	H616Q	probably benign	Het
Trip10	A	T	17: 57,261,288		probably null	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ubr4	A	G	4: 139,410,649	T1106A	probably benign	Het
Vmn1r84	A	T	7: 12,362,458	S103T	probably benign	Het
Vps13a	G	T	19: 16,685,315	P1602Q	probably damaging	Het

Other mutations in Hip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Hip1	APN	5	135449822	missense	probably damaging	1.00
IGL00418:Hip1	APN	5	135426346	missense	probably damaging	1.00
IGL01744:Hip1	APN	5	135545063	utr 5 prime	probably benign
IGL02494:Hip1	APN	5	135444791	nonsense	probably null
IGL02749:Hip1	APN	5	135444751	missense	probably benign	0.00
IGL03219:Hip1	APN	5	135457050	missense	probably benign	0.16
IGL03328:Hip1	APN	5	135424874	missense	probably damaging	1.00
R0100:Hip1	UTSW	5	135436453	missense	probably benign
R0100:Hip1	UTSW	5	135436453	missense	probably benign
R0336:Hip1	UTSW	5	135428613	missense	probably benign	0.39
R0410:Hip1	UTSW	5	135458155	missense	probably damaging	1.00
R1454:Hip1	UTSW	5	135438632	missense	probably benign
R1530:Hip1	UTSW	5	135444780	missense	probably damaging	1.00
R1848:Hip1	UTSW	5	135435141	unclassified	probably null
R2201:Hip1	UTSW	5	135431730	missense	probably benign
R2246:Hip1	UTSW	5	135452844	missense	probably damaging	1.00
R2276:Hip1	UTSW	5	135457046	missense	probably damaging	1.00
R2353:Hip1	UTSW	5	135412712	missense	probably damaging	1.00
R3013:Hip1	UTSW	5	135435039	missense	possibly damaging	0.91
R3413:Hip1	UTSW	5	135422172	missense	probably damaging	1.00
R3939:Hip1	UTSW	5	135428764	missense	probably benign	0.14
R4153:Hip1	UTSW	5	135412706	missense	probably damaging	1.00
R4839:Hip1	UTSW	5	135426318	splice site	probably null
R5059:Hip1	UTSW	5	135449821	missense	probably damaging	1.00
R5171:Hip1	UTSW	5	135440302	missense	probably damaging	1.00
R5358:Hip1	UTSW	5	135436398	missense	probably benign	0.22
R5642:Hip1	UTSW	5	135433085	nonsense	probably null
R5646:Hip1	UTSW	5	135428741	missense	probably damaging	0.98
R5831:Hip1	UTSW	5	135411263	missense	probably benign	0.00
R5908:Hip1	UTSW	5	135424863	critical splice donor site	probably null
R6484:Hip1	UTSW	5	135440129	missense	probably damaging	1.00
R6535:Hip1	UTSW	5	135428497	splice site	probably null
R6557:Hip1	UTSW	5	135428719	missense	possibly damaging	0.67
R7459:Hip1	UTSW	5	135414297	missense	probably damaging	1.00
R7589:Hip1	UTSW	5	135414311	missense	probably benign
R7677:Hip1	UTSW	5	135430317	missense	probably benign
Z1177:Hip1	UTSW	5	135428606	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTGGGGTCAAGAATTAGGAGTGT -3'
(R):5'- ACAACCTTTTATGTCCGCTTCA -3'

Sequencing Primer
(F):5'- AGCTTCACAGGTCTGATGC -3'
(R):5'- CTAGCTTGGGTTACATAGCAAGACC -3'

Posted On

2016-07-22