Incidental Mutation 'R5189:Vmn1r84'
ID405056
Institutional Source Beutler Lab
Gene Symbol Vmn1r84
Ensembl Gene ENSMUSG00000066803
Gene Namevomeronasal 1 receptor 84
SynonymsV1rg11
MMRRC Submission 042767-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5189 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location12360313-12369273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12362458 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 103 (S103T)
Ref Sequence ENSEMBL: ENSMUSP00000083405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086228] [ENSMUST00000226408] [ENSMUST00000227427] [ENSMUST00000228653]
Predicted Effect probably benign
Transcript: ENSMUST00000086228
AA Change: S103T

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000083405
Gene: ENSMUSG00000066803
AA Change: S103T

DomainStartEndE-ValueType
Pfam:TAS2R 16 312 3.7e-11 PFAM
Pfam:V1R 45 308 1.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177845
Predicted Effect probably benign
Transcript: ENSMUST00000226408
AA Change: S91T

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226811
Predicted Effect probably benign
Transcript: ENSMUST00000227427
AA Change: S91T

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000228653
AA Change: S91T

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228741
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik C T 12: 71,193,349 T1311I possibly damaging Het
4930505A04Rik T C 11: 30,426,169 T233A probably damaging Het
Ankar T C 1: 72,658,414 I859V probably benign Het
Cacnb2 G T 2: 14,986,038 A644S possibly damaging Het
Gatb T C 3: 85,636,931 V402A probably benign Het
Gpcpd1 T C 2: 132,553,972 K153R probably damaging Het
Hip1 A G 5: 135,434,293 L60S probably damaging Het
Hsf4 GCAGCACCGGGTCA G 8: 105,271,428 probably null Het
Hydin A T 8: 110,413,211 probably null Het
Igsf3 A T 3: 101,431,527 T386S possibly damaging Het
Il12rb1 A G 8: 70,811,058 T88A possibly damaging Het
Kank1 T C 19: 25,424,181 S1051P probably damaging Het
Kap A G 6: 133,851,916 probably null Het
Ly96 A G 1: 16,700,867 E74G probably damaging Het
Map7d1 G T 4: 126,242,304 probably null Het
Megf6 G T 4: 154,252,523 R253L probably benign Het
Mex3b A G 7: 82,869,251 D258G probably damaging Het
Mpzl3 T C 9: 45,062,110 I49T possibly damaging Het
Myh15 C A 16: 49,101,507 T472N probably benign Het
Nacad A G 11: 6,601,611 S527P probably damaging Het
Nkx2-3 T G 19: 43,612,708 S70A probably benign Het
Nkx2-6 A T 14: 69,171,893 Q31L probably benign Het
Olfr522 A G 7: 140,162,719 V77A probably damaging Het
Pcdha6 A T 18: 36,968,791 N346Y probably damaging Het
Pkd2 G A 5: 104,459,919 D95N probably benign Het
Pkhd1l1 A G 15: 44,547,148 T2684A probably damaging Het
Plin2 A G 4: 86,657,146 Y389H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc41a2 T C 10: 83,313,411 probably null Het
Smg6 A G 11: 75,041,996 T1038A probably damaging Het
Suds3 T C 5: 117,100,599 probably benign Het
Tbc1d8 T C 1: 39,385,132 H626R probably benign Het
Tmem260 T A 14: 48,509,116 H616Q probably benign Het
Trip10 A T 17: 57,261,288 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 A G 4: 139,410,649 T1106A probably benign Het
Vps13a G T 19: 16,685,315 P1602Q probably damaging Het
Other mutations in Vmn1r84
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02505:Vmn1r84 APN 7 12362419 missense probably damaging 1.00
K3955:Vmn1r84 UTSW 7 12361957 missense probably damaging 0.98
R0360:Vmn1r84 UTSW 7 12361872 missense probably damaging 1.00
R0399:Vmn1r84 UTSW 7 12361867 missense probably benign 0.26
R0697:Vmn1r84 UTSW 7 12362763 start codon destroyed probably null 0.53
R1613:Vmn1r84 UTSW 7 12362533 missense possibly damaging 0.80
R1636:Vmn1r84 UTSW 7 12362595 missense probably benign 0.12
R1872:Vmn1r84 UTSW 7 12362628 missense probably benign 0.17
R4022:Vmn1r84 UTSW 7 12361930 missense probably benign
R4923:Vmn1r84 UTSW 7 12361816 missense probably benign
R5275:Vmn1r84 UTSW 7 12361814 missense probably benign
R5721:Vmn1r84 UTSW 7 12362226 missense probably damaging 1.00
R6151:Vmn1r84 UTSW 7 12361914 missense possibly damaging 0.72
R7261:Vmn1r84 UTSW 7 12362142 missense probably damaging 1.00
R7513:Vmn1r84 UTSW 7 12362067 missense probably benign 0.00
R7573:Vmn1r84 UTSW 7 12361860 missense probably benign 0.17
R8039:Vmn1r84 UTSW 7 12362008 missense possibly damaging 0.67
Z1177:Vmn1r84 UTSW 7 12362512 missense probably benign 0.00
Z1177:Vmn1r84 UTSW 7 12362659 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GGTCCAATCACATCTATAGCTGTC -3'
(R):5'- TGGGAATCCTTGGTAACTGGTC -3'

Sequencing Primer
(F):5'- ATAGCTGTCTTGATGTTTAGAAGCAG -3'
(R):5'- GGAATCCTTGGTAACTGGTCAATTC -3'
Posted On2016-07-22