Incidental Mutation 'R5189:Mex3b'
ID405057
Institutional Source Beutler Lab
Gene Symbol Mex3b
Ensembl Gene ENSMUSG00000057706
Gene Namemex3 RNA binding family member B
Synonyms4931439A04Rik, Rkhd3
MMRRC Submission 042767-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R5189 (G1)
Quality Score179
Status Not validated
Chromosome7
Chromosomal Location82867333-82871515 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82869251 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 258 (D258G)
Ref Sequence ENSEMBL: ENSMUSP00000082168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082237]
Predicted Effect probably damaging
Transcript: ENSMUST00000082237
AA Change: D258G

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082168
Gene: ENSMUSG00000057706
AA Change: D258G

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
low complexity region 35 61 N/A INTRINSIC
KH 71 139 2.54e-9 SMART
KH 166 233 1.6e-15 SMART
low complexity region 262 270 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 309 320 N/A INTRINSIC
low complexity region 337 346 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 389 424 N/A INTRINSIC
low complexity region 472 486 N/A INTRINSIC
low complexity region 494 515 N/A INTRINSIC
RING 525 564 3.24e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209046
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding phosphoprotein that is part of the MEX3 (muscle excess 3) family of translational regulators. The encoded protein contains N-terminal nuclear export and nuclear localization signals and is exported from the cytoplasm to the nucleus. The protein binds to RNA via two KH domains and also colocalizes with MEX3A, Dcp1A decapping factor and Argonaute proteins within P (processing) bodies. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygous inactivation of this gene leads to partial neonatal lethality, decreased body weight and subfertility. Males show seminiferous tubule obstruction, oligozoospermia, abnormalities in Sertoli cell barrier morphology and function, and impaired Sertoli cell and macrophage phagocytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik C T 12: 71,193,349 T1311I possibly damaging Het
4930505A04Rik T C 11: 30,426,169 T233A probably damaging Het
Ankar T C 1: 72,658,414 I859V probably benign Het
Cacnb2 G T 2: 14,986,038 A644S possibly damaging Het
Gatb T C 3: 85,636,931 V402A probably benign Het
Gpcpd1 T C 2: 132,553,972 K153R probably damaging Het
Hip1 A G 5: 135,434,293 L60S probably damaging Het
Hsf4 GCAGCACCGGGTCA G 8: 105,271,428 probably null Het
Hydin A T 8: 110,413,211 probably null Het
Igsf3 A T 3: 101,431,527 T386S possibly damaging Het
Il12rb1 A G 8: 70,811,058 T88A possibly damaging Het
Kank1 T C 19: 25,424,181 S1051P probably damaging Het
Kap A G 6: 133,851,916 probably null Het
Ly96 A G 1: 16,700,867 E74G probably damaging Het
Map7d1 G T 4: 126,242,304 probably null Het
Megf6 G T 4: 154,252,523 R253L probably benign Het
Mpzl3 T C 9: 45,062,110 I49T possibly damaging Het
Myh15 C A 16: 49,101,507 T472N probably benign Het
Nacad A G 11: 6,601,611 S527P probably damaging Het
Nkx2-3 T G 19: 43,612,708 S70A probably benign Het
Nkx2-6 A T 14: 69,171,893 Q31L probably benign Het
Olfr522 A G 7: 140,162,719 V77A probably damaging Het
Pcdha6 A T 18: 36,968,791 N346Y probably damaging Het
Pkd2 G A 5: 104,459,919 D95N probably benign Het
Pkhd1l1 A G 15: 44,547,148 T2684A probably damaging Het
Plin2 A G 4: 86,657,146 Y389H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc41a2 T C 10: 83,313,411 probably null Het
Smg6 A G 11: 75,041,996 T1038A probably damaging Het
Suds3 T C 5: 117,100,599 probably benign Het
Tbc1d8 T C 1: 39,385,132 H626R probably benign Het
Tmem260 T A 14: 48,509,116 H616Q probably benign Het
Trip10 A T 17: 57,261,288 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 A G 4: 139,410,649 T1106A probably benign Het
Vmn1r84 A T 7: 12,362,458 S103T probably benign Het
Vps13a G T 19: 16,685,315 P1602Q probably damaging Het
Other mutations in Mex3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Mex3b APN 7 82868908 missense probably damaging 1.00
IGL01112:Mex3b APN 7 82869703 missense probably benign 0.41
IGL01490:Mex3b APN 7 82869827 missense possibly damaging 0.71
IGL01809:Mex3b APN 7 82869712 missense probably benign
IGL02328:Mex3b APN 7 82869712 missense probably benign
R0218:Mex3b UTSW 7 82869104 missense probably damaging 1.00
R0653:Mex3b UTSW 7 82869034 missense probably damaging 1.00
R2360:Mex3b UTSW 7 82867862 missense probably benign 0.16
R4184:Mex3b UTSW 7 82870030 missense probably benign 0.00
R4397:Mex3b UTSW 7 82869823 missense possibly damaging 0.88
R4771:Mex3b UTSW 7 82869065 missense possibly damaging 0.81
R4945:Mex3b UTSW 7 82870174 missense probably benign 0.03
R6962:Mex3b UTSW 7 82869265 missense probably benign 0.00
R7021:Mex3b UTSW 7 82869872 missense possibly damaging 0.49
R7381:Mex3b UTSW 7 82868865 missense possibly damaging 0.85
R7483:Mex3b UTSW 7 82867906 missense possibly damaging 0.89
RF009:Mex3b UTSW 7 82867760 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TATATTGTGACACCCAGCCG -3'
(R):5'- TGTGAGCAAAGCTGAGTGC -3'

Sequencing Primer
(F):5'- CCGAGACAAGGAGCCAGTTTTC -3'
(R):5'- GCGTGAAGTAGCAGCTGC -3'
Posted On2016-07-22