Incidental Mutation 'R5189:Olfr522'
ID405058
Institutional Source Beutler Lab
Gene Symbol Olfr522
Ensembl Gene ENSMUSG00000051180
Gene Nameolfactory receptor 522
SynonymsMOR103-5, GA_x6K02T2PBJ9-42315125-42314187
MMRRC Submission 042767-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5189 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140159999-140164764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140162719 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 77 (V77A)
Ref Sequence ENSEMBL: ENSMUSP00000057288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050585]
Predicted Effect probably damaging
Transcript: ENSMUST00000050585
AA Change: V77A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057288
Gene: ENSMUSG00000051180
AA Change: V77A

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 1.7e-54 PFAM
Pfam:7tm_1 42 291 1.2e-21 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik C T 12: 71,193,349 T1311I possibly damaging Het
4930505A04Rik T C 11: 30,426,169 T233A probably damaging Het
Ankar T C 1: 72,658,414 I859V probably benign Het
Cacnb2 G T 2: 14,986,038 A644S possibly damaging Het
Gatb T C 3: 85,636,931 V402A probably benign Het
Gpcpd1 T C 2: 132,553,972 K153R probably damaging Het
Hip1 A G 5: 135,434,293 L60S probably damaging Het
Hsf4 GCAGCACCGGGTCA G 8: 105,271,428 probably null Het
Hydin A T 8: 110,413,211 probably null Het
Igsf3 A T 3: 101,431,527 T386S possibly damaging Het
Il12rb1 A G 8: 70,811,058 T88A possibly damaging Het
Kank1 T C 19: 25,424,181 S1051P probably damaging Het
Kap A G 6: 133,851,916 probably null Het
Ly96 A G 1: 16,700,867 E74G probably damaging Het
Map7d1 G T 4: 126,242,304 probably null Het
Megf6 G T 4: 154,252,523 R253L probably benign Het
Mex3b A G 7: 82,869,251 D258G probably damaging Het
Mpzl3 T C 9: 45,062,110 I49T possibly damaging Het
Myh15 C A 16: 49,101,507 T472N probably benign Het
Nacad A G 11: 6,601,611 S527P probably damaging Het
Nkx2-3 T G 19: 43,612,708 S70A probably benign Het
Nkx2-6 A T 14: 69,171,893 Q31L probably benign Het
Pcdha6 A T 18: 36,968,791 N346Y probably damaging Het
Pkd2 G A 5: 104,459,919 D95N probably benign Het
Pkhd1l1 A G 15: 44,547,148 T2684A probably damaging Het
Plin2 A G 4: 86,657,146 Y389H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc41a2 T C 10: 83,313,411 probably null Het
Smg6 A G 11: 75,041,996 T1038A probably damaging Het
Suds3 T C 5: 117,100,599 probably benign Het
Tbc1d8 T C 1: 39,385,132 H626R probably benign Het
Tmem260 T A 14: 48,509,116 H616Q probably benign Het
Trip10 A T 17: 57,261,288 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 A G 4: 139,410,649 T1106A probably benign Het
Vmn1r84 A T 7: 12,362,458 S103T probably benign Het
Vps13a G T 19: 16,685,315 P1602Q probably damaging Het
Other mutations in Olfr522
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01806:Olfr522 APN 7 140162928 missense probably benign 0.01
IGL02121:Olfr522 APN 7 140162694 missense probably benign 0.10
IGL02399:Olfr522 APN 7 140162600 missense probably benign
IGL02803:Olfr522 APN 7 140162374 missense possibly damaging 0.92
R0446:Olfr522 UTSW 7 140162471 missense probably damaging 1.00
R0538:Olfr522 UTSW 7 140162231 missense probably damaging 1.00
R0707:Olfr522 UTSW 7 140162089 missense probably damaging 1.00
R1466:Olfr522 UTSW 7 140162203 missense probably damaging 1.00
R1466:Olfr522 UTSW 7 140162203 missense probably damaging 1.00
R1584:Olfr522 UTSW 7 140162203 missense probably damaging 1.00
R1893:Olfr522 UTSW 7 140162821 missense probably damaging 1.00
R1895:Olfr522 UTSW 7 140162813 missense possibly damaging 0.82
R2004:Olfr522 UTSW 7 140162816 missense probably damaging 0.98
R2060:Olfr522 UTSW 7 140162824 missense probably damaging 1.00
R2067:Olfr522 UTSW 7 140162909 missense possibly damaging 0.69
R4841:Olfr522 UTSW 7 140162689 missense possibly damaging 0.94
R4842:Olfr522 UTSW 7 140162689 missense possibly damaging 0.94
R4956:Olfr522 UTSW 7 140162080 missense possibly damaging 0.70
R5325:Olfr522 UTSW 7 140162113 missense probably damaging 1.00
R5441:Olfr522 UTSW 7 140162651 missense probably benign 0.36
R5618:Olfr522 UTSW 7 140162272 missense probably damaging 1.00
R6031:Olfr522 UTSW 7 140162809 missense possibly damaging 0.82
R6031:Olfr522 UTSW 7 140162809 missense possibly damaging 0.82
R6609:Olfr522 UTSW 7 140162563 missense probably benign
R7154:Olfr522 UTSW 7 140162084 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGAATCCATGATGGCTGGG -3'
(R):5'- ACAACGCTTTGGTGACAGAG -3'

Sequencing Primer
(F):5'- AATCCATGATGGCTGGGTAGTGC -3'
(R):5'- AACGCTTTGGTGACAGAGTTCATTC -3'
Posted On2016-07-22