Incidental Mutation 'R5189:Hsf4'
ID405060
Institutional Source Beutler Lab
Gene Symbol Hsf4
Ensembl Gene ENSMUSG00000033249
Gene Nameheat shock transcription factor 4
Synonymsldis1
MMRRC Submission 042767-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5189 (G1)
Quality Score217
Status Not validated
Chromosome8
Chromosomal Location105269801-105275845 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GCAGCACCGGGTCA to G at 105271428 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014920] [ENSMUST00000036127] [ENSMUST00000036221] [ENSMUST00000126923] [ENSMUST00000163734] [ENSMUST00000172525] [ENSMUST00000173102] [ENSMUST00000173640] [ENSMUST00000173859] [ENSMUST00000174837]
Predicted Effect probably benign
Transcript: ENSMUST00000014920
SMART Domains Protein: ENSMUSP00000014920
Gene: ENSMUSG00000014776

DomainStartEndE-ValueType
CARD 4 92 2.1e-27 SMART
low complexity region 149 161 N/A INTRINSIC
low complexity region 173 209 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000036127
SMART Domains Protein: ENSMUSP00000048904
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 383 8e-88 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000036221
SMART Domains Protein: ENSMUSP00000038638
Gene: ENSMUSG00000033313

DomainStartEndE-ValueType
FBOX 8 48 2.72e-6 SMART
low complexity region 102 113 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126923
SMART Domains Protein: ENSMUSP00000115366
Gene: ENSMUSG00000033313

DomainStartEndE-ValueType
FBOX 8 48 2.72e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163734
SMART Domains Protein: ENSMUSP00000126278
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 9 60 1.43e-1 SMART
Blast:HSF 99 323 2e-88 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000172525
SMART Domains Protein: ENSMUSP00000134206
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 243 3e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173102
Predicted Effect probably null
Transcript: ENSMUST00000173640
SMART Domains Protein: ENSMUSP00000133532
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 284 1e-50 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000173859
SMART Domains Protein: ENSMUSP00000134213
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 353 1e-46 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000174837
SMART Domains Protein: ENSMUSP00000134477
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 290 3e-50 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heat-shock transcription factors (HSFs) activate heat-shock response genes under conditions of heat or other stresses. HSF4 lacks the carboxyl-terminal hydrophobic repeat which is shared among all vertebrate HSFs and has been suggested to be involved in the negative regulation of DNA binding activity. Two alternatively spliced transcripts encoding distinct isoforms and possessing different transcriptional activity have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display abnormal lens morphology and cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik C T 12: 71,193,349 T1311I possibly damaging Het
4930505A04Rik T C 11: 30,426,169 T233A probably damaging Het
Ankar T C 1: 72,658,414 I859V probably benign Het
Cacnb2 G T 2: 14,986,038 A644S possibly damaging Het
Gatb T C 3: 85,636,931 V402A probably benign Het
Gpcpd1 T C 2: 132,553,972 K153R probably damaging Het
Hip1 A G 5: 135,434,293 L60S probably damaging Het
Hydin A T 8: 110,413,211 probably null Het
Igsf3 A T 3: 101,431,527 T386S possibly damaging Het
Il12rb1 A G 8: 70,811,058 T88A possibly damaging Het
Kank1 T C 19: 25,424,181 S1051P probably damaging Het
Kap A G 6: 133,851,916 probably null Het
Ly96 A G 1: 16,700,867 E74G probably damaging Het
Map7d1 G T 4: 126,242,304 probably null Het
Megf6 G T 4: 154,252,523 R253L probably benign Het
Mex3b A G 7: 82,869,251 D258G probably damaging Het
Mpzl3 T C 9: 45,062,110 I49T possibly damaging Het
Myh15 C A 16: 49,101,507 T472N probably benign Het
Nacad A G 11: 6,601,611 S527P probably damaging Het
Nkx2-3 T G 19: 43,612,708 S70A probably benign Het
Nkx2-6 A T 14: 69,171,893 Q31L probably benign Het
Olfr522 A G 7: 140,162,719 V77A probably damaging Het
Pcdha6 A T 18: 36,968,791 N346Y probably damaging Het
Pkd2 G A 5: 104,459,919 D95N probably benign Het
Pkhd1l1 A G 15: 44,547,148 T2684A probably damaging Het
Plin2 A G 4: 86,657,146 Y389H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc41a2 T C 10: 83,313,411 probably null Het
Smg6 A G 11: 75,041,996 T1038A probably damaging Het
Suds3 T C 5: 117,100,599 probably benign Het
Tbc1d8 T C 1: 39,385,132 H626R probably benign Het
Tmem260 T A 14: 48,509,116 H616Q probably benign Het
Trip10 A T 17: 57,261,288 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 A G 4: 139,410,649 T1106A probably benign Het
Vmn1r84 A T 7: 12,362,458 S103T probably benign Het
Vps13a G T 19: 16,685,315 P1602Q probably damaging Het
Other mutations in Hsf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Hsf4 APN 8 105275657 makesense probably null
IGL01702:Hsf4 APN 8 105271589 missense probably damaging 1.00
IGL02040:Hsf4 APN 8 105275667 unclassified probably benign
R0115:Hsf4 UTSW 8 105272704 critical splice acceptor site probably null
R0449:Hsf4 UTSW 8 105275590 missense probably benign 0.04
R0585:Hsf4 UTSW 8 105271031 missense probably damaging 1.00
R1365:Hsf4 UTSW 8 105271094 missense probably damaging 0.99
R1401:Hsf4 UTSW 8 105275603 missense probably benign
R2276:Hsf4 UTSW 8 105269996 missense probably null 0.91
R2278:Hsf4 UTSW 8 105269996 missense probably null 0.91
R3848:Hsf4 UTSW 8 105270837 missense probably damaging 1.00
R3850:Hsf4 UTSW 8 105270837 missense probably damaging 1.00
R4240:Hsf4 UTSW 8 105274881 missense possibly damaging 0.58
R4781:Hsf4 UTSW 8 105274752 critical splice donor site probably null
R4790:Hsf4 UTSW 8 105270605 missense probably damaging 1.00
R4917:Hsf4 UTSW 8 105272735 missense probably benign 0.00
R4918:Hsf4 UTSW 8 105272735 missense probably benign 0.00
R4930:Hsf4 UTSW 8 105272698 splice site probably null
R5110:Hsf4 UTSW 8 105272795 missense probably benign 0.01
R6001:Hsf4 UTSW 8 105272909 missense possibly damaging 0.70
R6167:Hsf4 UTSW 8 105270849 missense probably damaging 1.00
R6802:Hsf4 UTSW 8 105274668 missense probably damaging 1.00
R7231:Hsf4 UTSW 8 105272147 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATGGGTCCAACTCTGAAACTTTAG -3'
(R):5'- TGTCTGAAGTGGCCCAAACAG -3'

Sequencing Primer
(F):5'- TATAAGATGAGTATCCCCTCTGCTGG -3'
(R):5'- GGCACTGGATTAGCTGAAAAG -3'
Posted On2016-07-22