Incidental Mutation 'R5189:Mpzl3'
ID405062
Institutional Source Beutler Lab
Gene Symbol Mpzl3
Ensembl Gene ENSMUSG00000070305
Gene Namemyelin protein zero-like 3
SynonymsA530065I17Rik, 5430427F17Rik, rc
MMRRC Submission 042767-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5189 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location45055186-45077436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45062110 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 49 (I49T)
Ref Sequence ENSEMBL: ENSMUSP00000110311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114663] [ENSMUST00000114664]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093856
SMART Domains Protein: ENSMUSP00000091378
Gene: ENSMUSG00000070305

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Blast:IG 38 82 5e-25 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000114663
AA Change: I49T

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110311
Gene: ENSMUSG00000070305
AA Change: I49T

DomainStartEndE-ValueType
IG 38 149 3.35e-5 SMART
Blast:IG_like 150 230 6e-26 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000114664
AA Change: I49T

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110312
Gene: ENSMUSG00000070305
AA Change: I49T

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
IG 38 149 3.35e-5 SMART
Blast:IG_like 150 229 3e-25 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187113
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous allele have a rough coat that becomes brittle and oily with age, and display stunted growth, cyclic and progressive hair loss, hyperplastic epidermis, abnormal hair follicles, myocardial degeneration, and reduced collagen and elastin content in the skin and heart. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik C T 12: 71,193,349 T1311I possibly damaging Het
4930505A04Rik T C 11: 30,426,169 T233A probably damaging Het
Ankar T C 1: 72,658,414 I859V probably benign Het
Cacnb2 G T 2: 14,986,038 A644S possibly damaging Het
Gatb T C 3: 85,636,931 V402A probably benign Het
Gpcpd1 T C 2: 132,553,972 K153R probably damaging Het
Hip1 A G 5: 135,434,293 L60S probably damaging Het
Hsf4 GCAGCACCGGGTCA G 8: 105,271,428 probably null Het
Hydin A T 8: 110,413,211 probably null Het
Igsf3 A T 3: 101,431,527 T386S possibly damaging Het
Il12rb1 A G 8: 70,811,058 T88A possibly damaging Het
Kank1 T C 19: 25,424,181 S1051P probably damaging Het
Kap A G 6: 133,851,916 probably null Het
Ly96 A G 1: 16,700,867 E74G probably damaging Het
Map7d1 G T 4: 126,242,304 probably null Het
Megf6 G T 4: 154,252,523 R253L probably benign Het
Mex3b A G 7: 82,869,251 D258G probably damaging Het
Myh15 C A 16: 49,101,507 T472N probably benign Het
Nacad A G 11: 6,601,611 S527P probably damaging Het
Nkx2-3 T G 19: 43,612,708 S70A probably benign Het
Nkx2-6 A T 14: 69,171,893 Q31L probably benign Het
Olfr522 A G 7: 140,162,719 V77A probably damaging Het
Pcdha6 A T 18: 36,968,791 N346Y probably damaging Het
Pkd2 G A 5: 104,459,919 D95N probably benign Het
Pkhd1l1 A G 15: 44,547,148 T2684A probably damaging Het
Plin2 A G 4: 86,657,146 Y389H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc41a2 T C 10: 83,313,411 probably null Het
Smg6 A G 11: 75,041,996 T1038A probably damaging Het
Suds3 T C 5: 117,100,599 probably benign Het
Tbc1d8 T C 1: 39,385,132 H626R probably benign Het
Tmem260 T A 14: 48,509,116 H616Q probably benign Het
Trip10 A T 17: 57,261,288 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 A G 4: 139,410,649 T1106A probably benign Het
Vmn1r84 A T 7: 12,362,458 S103T probably benign Het
Vps13a G T 19: 16,685,315 P1602Q probably damaging Het
Other mutations in Mpzl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02420:Mpzl3 APN 9 45066517 missense possibly damaging 0.95
IGL02969:Mpzl3 APN 9 45068216 missense probably benign 0.00
mausolus UTSW 9 45068252 missense probably damaging 1.00
satrap UTSW 9 45055244 start codon destroyed probably null 0.06
R0069:Mpzl3 UTSW 9 45068252 missense probably damaging 1.00
R0196:Mpzl3 UTSW 9 45062160 missense probably damaging 0.98
R0557:Mpzl3 UTSW 9 45066508 missense probably damaging 1.00
R1511:Mpzl3 UTSW 9 45066529 missense probably damaging 0.99
R4580:Mpzl3 UTSW 9 45068231 missense possibly damaging 0.94
R4775:Mpzl3 UTSW 9 45066432 missense probably damaging 1.00
R4825:Mpzl3 UTSW 9 45068329 missense probably benign 0.00
R4972:Mpzl3 UTSW 9 45062256 intron probably benign
R5371:Mpzl3 UTSW 9 45055212 utr 5 prime probably benign
R5925:Mpzl3 UTSW 9 45062114 missense probably damaging 1.00
R7191:Mpzl3 UTSW 9 45055244 start codon destroyed probably null 0.06
R7561:Mpzl3 UTSW 9 45055312 missense probably benign
R7570:Mpzl3 UTSW 9 45070687 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGGTGAGATCACTGAAAATGGTG -3'
(R):5'- ACAGCAGGTGACTTTACCCC -3'

Sequencing Primer
(F):5'- CTGAAAATGGTGTGAAGCATCTCTC -3'
(R):5'- AGGAATGGCCTCGATTTCC -3'
Posted On2016-07-22