Incidental Mutation 'R5189:Slc41a2'
ID405064
Institutional Source Beutler Lab
Gene Symbol Slc41a2
Ensembl Gene ENSMUSG00000034591
Gene Namesolute carrier family 41, member 2
SynonymsA230035L05Rik
MMRRC Submission 042767-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R5189 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location83230848-83337882 bp(-) (GRCm38)
Type of Mutationsplice site (2804 bp from exon)
DNA Base Change (assembly) T to C at 83313411 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039956] [ENSMUST00000039956] [ENSMUST00000126617] [ENSMUST00000154730] [ENSMUST00000154926]
Predicted Effect probably null
Transcript: ENSMUST00000039956
SMART Domains Protein: ENSMUSP00000036690
Gene: ENSMUSG00000034591

DomainStartEndE-ValueType
transmembrane domain 159 181 N/A INTRINSIC
Pfam:MgtE 200 334 8.7e-24 PFAM
transmembrane domain 346 368 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
Pfam:MgtE 414 557 2.9e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000039956
SMART Domains Protein: ENSMUSP00000036690
Gene: ENSMUSG00000034591

DomainStartEndE-ValueType
transmembrane domain 159 181 N/A INTRINSIC
Pfam:MgtE 200 334 8.7e-24 PFAM
transmembrane domain 346 368 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
Pfam:MgtE 414 557 2.9e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000126617
Predicted Effect probably null
Transcript: ENSMUST00000154730
Predicted Effect probably null
Transcript: ENSMUST00000154926
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik C T 12: 71,193,349 T1311I possibly damaging Het
4930505A04Rik T C 11: 30,426,169 T233A probably damaging Het
Ankar T C 1: 72,658,414 I859V probably benign Het
Cacnb2 G T 2: 14,986,038 A644S possibly damaging Het
Gatb T C 3: 85,636,931 V402A probably benign Het
Gpcpd1 T C 2: 132,553,972 K153R probably damaging Het
Hip1 A G 5: 135,434,293 L60S probably damaging Het
Hsf4 GCAGCACCGGGTCA G 8: 105,271,428 probably null Het
Hydin A T 8: 110,413,211 probably null Het
Igsf3 A T 3: 101,431,527 T386S possibly damaging Het
Il12rb1 A G 8: 70,811,058 T88A possibly damaging Het
Kank1 T C 19: 25,424,181 S1051P probably damaging Het
Kap A G 6: 133,851,916 probably null Het
Ly96 A G 1: 16,700,867 E74G probably damaging Het
Map7d1 G T 4: 126,242,304 probably null Het
Megf6 G T 4: 154,252,523 R253L probably benign Het
Mex3b A G 7: 82,869,251 D258G probably damaging Het
Mpzl3 T C 9: 45,062,110 I49T possibly damaging Het
Myh15 C A 16: 49,101,507 T472N probably benign Het
Nacad A G 11: 6,601,611 S527P probably damaging Het
Nkx2-3 T G 19: 43,612,708 S70A probably benign Het
Nkx2-6 A T 14: 69,171,893 Q31L probably benign Het
Olfr522 A G 7: 140,162,719 V77A probably damaging Het
Pcdha6 A T 18: 36,968,791 N346Y probably damaging Het
Pkd2 G A 5: 104,459,919 D95N probably benign Het
Pkhd1l1 A G 15: 44,547,148 T2684A probably damaging Het
Plin2 A G 4: 86,657,146 Y389H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Smg6 A G 11: 75,041,996 T1038A probably damaging Het
Suds3 T C 5: 117,100,599 probably benign Het
Tbc1d8 T C 1: 39,385,132 H626R probably benign Het
Tmem260 T A 14: 48,509,116 H616Q probably benign Het
Trip10 A T 17: 57,261,288 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 A G 4: 139,410,649 T1106A probably benign Het
Vmn1r84 A T 7: 12,362,458 S103T probably benign Het
Vps13a G T 19: 16,685,315 P1602Q probably damaging Het
Other mutations in Slc41a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Slc41a2 APN 10 83313530 unclassified probably benign
IGL02263:Slc41a2 APN 10 83313500 missense possibly damaging 0.82
IGL02338:Slc41a2 APN 10 83316591 missense possibly damaging 0.68
IGL02680:Slc41a2 APN 10 83283864 missense probably benign 0.20
IGL02703:Slc41a2 APN 10 83254847 missense probably damaging 1.00
IGL03039:Slc41a2 APN 10 83283858 missense probably benign 0.37
PIT4508001:Slc41a2 UTSW 10 83254880 missense probably damaging 0.99
R0326:Slc41a2 UTSW 10 83283746 missense probably damaging 1.00
R0470:Slc41a2 UTSW 10 83316222 missense possibly damaging 0.94
R0610:Slc41a2 UTSW 10 83283728 missense possibly damaging 0.75
R1708:Slc41a2 UTSW 10 83233732 missense probably damaging 1.00
R1765:Slc41a2 UTSW 10 83301266 missense probably damaging 1.00
R1870:Slc41a2 UTSW 10 83301165 nonsense probably null
R1875:Slc41a2 UTSW 10 83256085 missense probably damaging 1.00
R2008:Slc41a2 UTSW 10 83304303 critical splice donor site probably null
R2172:Slc41a2 UTSW 10 83283774 missense probably benign 0.00
R4193:Slc41a2 UTSW 10 83301221 missense probably damaging 0.97
R4789:Slc41a2 UTSW 10 83316456 missense probably damaging 1.00
R4861:Slc41a2 UTSW 10 83316458 missense probably damaging 0.99
R4861:Slc41a2 UTSW 10 83316458 missense probably damaging 0.99
R4913:Slc41a2 UTSW 10 83313420 missense probably damaging 1.00
R5012:Slc41a2 UTSW 10 83301263 missense probably benign 0.02
R5140:Slc41a2 UTSW 10 83297291 missense probably damaging 0.98
R5410:Slc41a2 UTSW 10 83281368 critical splice donor site probably null
R5748:Slc41a2 UTSW 10 83297159 missense probably benign 0.00
R5808:Slc41a2 UTSW 10 83313498 missense probably benign 0.29
R6124:Slc41a2 UTSW 10 83297252 missense probably damaging 1.00
R6292:Slc41a2 UTSW 10 83254926 missense probably damaging 0.99
R6511:Slc41a2 UTSW 10 83283788 missense probably damaging 0.99
R6793:Slc41a2 UTSW 10 83301158 splice site probably null
R6970:Slc41a2 UTSW 10 83316096 missense possibly damaging 0.53
R7584:Slc41a2 UTSW 10 83316789 splice site probably benign
R7752:Slc41a2 UTSW 10 83256041 missense possibly damaging 0.73
R8289:Slc41a2 UTSW 10 83301180 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGCAAACGTACTGTGGCTTC -3'
(R):5'- TTGAGAATAAACTCCACCTCTCTC -3'

Sequencing Primer
(F):5'- AGAAGCAGGTCCATCGCCTC -3'
(R):5'- AAACTCCACCTCTCTCTTTAGAAGGG -3'
Posted On2016-07-22