Incidental Mutation 'R5189:4930505A04Rik'
ID405066
Institutional Source Beutler Lab
Gene Symbol 4930505A04Rik
Ensembl Gene ENSMUSG00000040919
Gene NameRIKEN cDNA 4930505A04 gene
Synonyms
MMRRC Submission 042767-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5189 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location30426006-30471827 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30426169 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 233 (T233A)
Ref Sequence ENSEMBL: ENSMUSP00000045288 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000041763
AA Change: T233A

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000152718
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik C T 12: 71,193,349 T1311I possibly damaging Het
Ankar T C 1: 72,658,414 I859V probably benign Het
Cacnb2 G T 2: 14,986,038 A644S possibly damaging Het
Gatb T C 3: 85,636,931 V402A probably benign Het
Gpcpd1 T C 2: 132,553,972 K153R probably damaging Het
Hip1 A G 5: 135,434,293 L60S probably damaging Het
Hsf4 GCAGCACCGGGTCA G 8: 105,271,428 probably null Het
Hydin A T 8: 110,413,211 probably null Het
Igsf3 A T 3: 101,431,527 T386S possibly damaging Het
Il12rb1 A G 8: 70,811,058 T88A possibly damaging Het
Kank1 T C 19: 25,424,181 S1051P probably damaging Het
Kap A G 6: 133,851,916 probably null Het
Ly96 A G 1: 16,700,867 E74G probably damaging Het
Map7d1 G T 4: 126,242,304 probably null Het
Megf6 G T 4: 154,252,523 R253L probably benign Het
Mex3b A G 7: 82,869,251 D258G probably damaging Het
Mpzl3 T C 9: 45,062,110 I49T possibly damaging Het
Myh15 C A 16: 49,101,507 T472N probably benign Het
Nacad A G 11: 6,601,611 S527P probably damaging Het
Nkx2-3 T G 19: 43,612,708 S70A probably benign Het
Nkx2-6 A T 14: 69,171,893 Q31L probably benign Het
Olfr522 A G 7: 140,162,719 V77A probably damaging Het
Pcdha6 A T 18: 36,968,791 N346Y probably damaging Het
Pkd2 G A 5: 104,459,919 D95N probably benign Het
Pkhd1l1 A G 15: 44,547,148 T2684A probably damaging Het
Plin2 A G 4: 86,657,146 Y389H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc41a2 T C 10: 83,313,411 probably null Het
Smg6 A G 11: 75,041,996 T1038A probably damaging Het
Suds3 T C 5: 117,100,599 probably benign Het
Tbc1d8 T C 1: 39,385,132 H626R probably benign Het
Tmem260 T A 14: 48,509,116 H616Q probably benign Het
Trip10 A T 17: 57,261,288 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 A G 4: 139,410,649 T1106A probably benign Het
Vmn1r84 A T 7: 12,362,458 S103T probably benign Het
Vps13a G T 19: 16,685,315 P1602Q probably damaging Het
Other mutations in 4930505A04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:4930505A04Rik APN 11 30454843 missense possibly damaging 0.69
IGL01545:4930505A04Rik APN 11 30426228 missense probably benign 0.13
R0400:4930505A04Rik UTSW 11 30426360 missense probably benign 0.09
R1029:4930505A04Rik UTSW 11 30426177 missense probably damaging 0.96
R1029:4930505A04Rik UTSW 11 30446389 splice site probably benign
R1585:4930505A04Rik UTSW 11 30427175 splice site probably benign
R4708:4930505A04Rik UTSW 11 30454717 missense probably damaging 0.98
R4993:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R4994:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R4995:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R4996:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5187:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5330:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5333:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5448:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5449:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5450:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5475:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5477:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5665:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5823:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5832:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5833:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5835:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5873:4930505A04Rik UTSW 11 30426220 nonsense probably null
R6032:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R6032:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R6037:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R6037:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R6058:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R6224:4930505A04Rik UTSW 11 30454815 missense probably benign 0.44
RF046:4930505A04Rik UTSW 11 30426249 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCCCACACATTCTCAGGATTACAG -3'
(R):5'- ACATGGAACCTTCGTGCAGAG -3'

Sequencing Primer
(F):5'- GGATTACAGTCTTAAACACCAAGG -3'
(R):5'- CCTTCGTGCAGAGAGAGATAAAAC -3'
Posted On2016-07-22