Incidental Mutation 'R5189:Nkx2-6'
ID405072
Institutional Source Beutler Lab
Gene Symbol Nkx2-6
Ensembl Gene ENSMUSG00000044186
Gene NameNK2 homeobox 6
SynonymsNkx-2.6, tinman, Tix, Nkx2.6
MMRRC Submission 042767-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5189 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location69171802-69175518 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69171893 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 31 (Q31L)
Ref Sequence ENSEMBL: ENSMUSP00000049898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062437]
Predicted Effect probably benign
Transcript: ENSMUST00000062437
AA Change: Q31L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000049898
Gene: ENSMUSG00000044186
AA Change: Q31L

DomainStartEndE-ValueType
HOX 123 185 1.64e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172547
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homeobox-containing protein that belongs to the NK-2 homeobox family. This protein is a vertebrate homolog of Drosophila homeobox-containing protein called 'tinman', which has been shown to be essential for development of the heart-like dorsal vessel. In conjunction with related gene, NKX2-5, this gene may play a role in both pharyngeal and cardiac embryonic development. Mutations in this gene are associated with persistent truncus arteriosus.[provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a targeted null allele are viable and fertile and develop normally, with no anomalies detected in the caudal pharyngeal pouch derivatives, heart or gut. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik C T 12: 71,193,349 T1311I possibly damaging Het
4930505A04Rik T C 11: 30,426,169 T233A probably damaging Het
Ankar T C 1: 72,658,414 I859V probably benign Het
Cacnb2 G T 2: 14,986,038 A644S possibly damaging Het
Gatb T C 3: 85,636,931 V402A probably benign Het
Gpcpd1 T C 2: 132,553,972 K153R probably damaging Het
Hip1 A G 5: 135,434,293 L60S probably damaging Het
Hsf4 GCAGCACCGGGTCA G 8: 105,271,428 probably null Het
Hydin A T 8: 110,413,211 probably null Het
Igsf3 A T 3: 101,431,527 T386S possibly damaging Het
Il12rb1 A G 8: 70,811,058 T88A possibly damaging Het
Kank1 T C 19: 25,424,181 S1051P probably damaging Het
Kap A G 6: 133,851,916 probably null Het
Ly96 A G 1: 16,700,867 E74G probably damaging Het
Map7d1 G T 4: 126,242,304 probably null Het
Megf6 G T 4: 154,252,523 R253L probably benign Het
Mex3b A G 7: 82,869,251 D258G probably damaging Het
Mpzl3 T C 9: 45,062,110 I49T possibly damaging Het
Myh15 C A 16: 49,101,507 T472N probably benign Het
Nacad A G 11: 6,601,611 S527P probably damaging Het
Nkx2-3 T G 19: 43,612,708 S70A probably benign Het
Olfr522 A G 7: 140,162,719 V77A probably damaging Het
Pcdha6 A T 18: 36,968,791 N346Y probably damaging Het
Pkd2 G A 5: 104,459,919 D95N probably benign Het
Pkhd1l1 A G 15: 44,547,148 T2684A probably damaging Het
Plin2 A G 4: 86,657,146 Y389H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc41a2 T C 10: 83,313,411 probably null Het
Smg6 A G 11: 75,041,996 T1038A probably damaging Het
Suds3 T C 5: 117,100,599 probably benign Het
Tbc1d8 T C 1: 39,385,132 H626R probably benign Het
Tmem260 T A 14: 48,509,116 H616Q probably benign Het
Trip10 A T 17: 57,261,288 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 A G 4: 139,410,649 T1106A probably benign Het
Vmn1r84 A T 7: 12,362,458 S103T probably benign Het
Vps13a G T 19: 16,685,315 P1602Q probably damaging Het
Other mutations in Nkx2-6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Nkx2-6 APN 14 69171877 missense probably benign
IGL01350:Nkx2-6 APN 14 69174773 missense probably damaging 1.00
FR4548:Nkx2-6 UTSW 14 69175229 missense probably damaging 1.00
FR4976:Nkx2-6 UTSW 14 69175229 missense probably damaging 1.00
R0583:Nkx2-6 UTSW 14 69174779 missense probably damaging 1.00
R1670:Nkx2-6 UTSW 14 69174677 missense probably benign 0.00
R2115:Nkx2-6 UTSW 14 69171839 missense probably damaging 1.00
R3692:Nkx2-6 UTSW 14 69172027 missense probably benign 0.09
R4624:Nkx2-6 UTSW 14 69174926 missense probably damaging 1.00
R5412:Nkx2-6 UTSW 14 69174746 missense probably damaging 0.97
R5583:Nkx2-6 UTSW 14 69171823 missense probably damaging 0.98
R6748:Nkx2-6 UTSW 14 69175106 missense probably benign
R7487:Nkx2-6 UTSW 14 69171940 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCCAGGACCTAGTGTGCATC -3'
(R):5'- CTCCCTCAATAACACCTGTAGG -3'

Sequencing Primer
(F):5'- TAGTGTGCATCCCAGAATCG -3'
(R):5'- CCTGTAGGAAAGAGCGCTTACTTAC -3'
Posted On2016-07-22